Description :
Non Conding Region
Location :
Scaffold_1:95173- 98660
Sequence
3487 bases(100 bases per row)
GCGAAGTTGACCATACTCGATGGAAAAAAAGACGGCTTTCTTCACGCTTGGGCGAAGGCAATGAATTGCACAGTCTCGCAGAGGCAGCAGCAGTACGACT
AGATGACGTTCTGCCAGTCAGTCAGTCACTTGTTGATGGTTGACAACCGAGAAAGAGAGATAAATAGAGATGGTTGTGGCTATTGGGCGAGTACTCTCAC
ACACCAACACACTCATACACTAGACGGAGCCCGTCTTTTCCGGCTTTTGCCAGCAGGTATTGAAATCGAGTGGAAAACAAGTGGTGTGTCAAGAGAGTCC
AGTCGAGAGTCGAAAGTCTCTGTTGTTCGTTGGTAGTATTGTATTGAAAGAGACAATGTCGCTCGACTTGCGGTCGTCCGGTTGTTCGTGGTGTTACTCA
CGCTGCTGACTGGCCACTTTCTGAACGAGAGGGTGGTCTGTCACCGGATCAGGTGAAGTCAGACCTCTGTCTTGATGTTTGTAAATGAAGAACCTACCCC
TCTTTTTGGTAGAAACCACTTGCAAGTCAATTTCGCCCAGGCGGTGGACATAGAAATGACCTCCAATTGACGATTACGTGCTAACGTGACCAGCACGATT
TTTGCTAGCCCGTTGACCTGCTGGGGCAGCTGTTGGTATAAAAGACACGTGGTAGACCCTTTACGAACGCAGATGTTGACGTCGATGCGAACGGGCTTTT
AAGTTTAGTGAGTGGATGTCGAGCGAGCGAAAAGCTCACAAACCATACAGTAGCTCAATGAGTGTGGGCGCAATCGGCGCAAGCGGTGTCATTTGTCGTT
TGCTCCAGGTTTCGTTGTGTTGACCTGCTCGTGAGGTCTGGTCTCTCTAGCTTTTACAGTTACTCGAAATGAAGTTGTAGAAATTGCTCATAAACGGTGT
CAATGACTTCGATTTTCGTTATTTGCCGTTCCGACGAACAGCTCCGTCACGAATTCGGGTGTGTGCATCGGGCCACAACTTTTTTTCGAATCGGGGACGT
TTAGTGAGACTGGACGCCATTTTATATGCGTCCCTCTACGTCAATAAACCCTGTAATTGGAAGTGCAGATGTCGGTATTACAACTCCAGCGCTGTCATTA
TTCACAGCACCGTGAAAAAATGCTCGTAGAACGTTGACAAGCATGGTCCAGAGATAACAAGTGCGAGGGCATAGAGGTAGCAAGTGCGAGGGCATAGAGA
TAGCAAGTGCGAGGGCATAGAGATAGCAAACAAGCACTTTGTTGTCTGTACCACTGGTAGATGAGAATAAACAGCTGATTTTTCCAATGTGAGTACGTGA
CGCGCAACTACAGATGTGGTGTTGATGAAGAATGGTTTACCGTCAAAAACAGCTGTGCTGGATATTGCTGGAGAACGCACACCCTCTACCCCTCACCACG
GTACGTCAAAGAATATTTCGCCTCCATATTGTCTCTGGTACGACTTCAGCAGTTGCCATCTGATGGGCACTCATTTGGATGTCTCGTCATGACGAATAAC
GCATACGCTCAATAATTCACATCTCTTGAGAGCTACACGATACTACAAGGACTTACAGAGCCGGAAAACGCTGCAATGCTGCGATGATGACATTCTTCCA
CGATCCTCACATGCAACAGCAGCTCTACTCTCGATGGAAGCGCTAAATTGCCTCGTTAATATGCTACGATGTGGTTTGAAGCAGTTTCGAAGGTGCTTGA
CAATAGACTTTGCGACCTTTCTAGTGTAGATATATGTACGCTAAAAGACCGTCCTGCGATATTCCATACATTTCGATGCGTCGACCTTTGCGTTAGGAGT
GAGGAAGTATTAGTACTGAAATCGGCAGCATTAAGCTTCGCCCTACGAAATCATGTGTACGGTAATATTTTACACATATTGCTTTGTCGGGATGCGCCAA
TGTTAAAGAAAAGAGCGACACCTTTTTCTGCGTGACGGACGCGAACGCTGAGGATGACACGCCAGACCACATGGAGGTAAAGTATATATCCAGAACAGAC
GAGGTGCCTCAACATTCGTCGAAGTCCATGGGGGATGTCATGAGTGGGTGAAAATGCTACGCACGTACAATAAAAACAAAAGCCTTATGCCAGCGGACGC
CTTACGTGCAAGCCCAAGGTTTTGTCACTAGGGACCGTATTTAGTAGTTAAGGATAATCGAAGTGATACTCTGTAACATTGAAGGGAGCACTTTTCTATC
GCATTTATGAAATTTATTTAAACTGCAAAATCTCGTAGCGTTGGCCTGAGTGATGCTCGATCAAGATCAGAAGGCAAATTTACCCTTGTGCATCGCTCAA
AAACGAAGTCTATGGAATGACTGCATCATGTCGGGGGAAGTACAGGCACTCTTTAACAGTAGTTGCAGTGATCGGTCCAACTTTGTCAATAAGAACAAGT
CAAGCGTAATCTCAAGTCGAACAAATTCCATAATTCCATTTTTCCGAGTTGGATGAAATGTCCATTTGCAAGACGAACGCTACACACAAGTTCACATCCA
GGAAAAAAGACACCAAATCAGCGTGTCGAATGCCCTAGCACAATTGTGTCAAAGCCGGAGAATTGTGCCAGATTGGCCGAAGAGTTATGGTCAATTTGAC
GTTGAAGTTCATGGCCAACAGTAAAAATTTCAACATTATGCTGCCGGCTCATTATAATGCCGGCTCGTTATGCTGACGGAGCTATGCAATAACTAGAGAG
AAAAAACTCTTCGGACGCTTGATTGAGAGGCAGTCAGCACTGCATCTTCGAGCTATAGGTAGTCGTTTCCCACTCATTTAGTCGTCAGAGCGGTCATTTT
CAGAAATAATGGTTCTTGTTGCCAGACACATCTCGTTGACTCCCACACTGGGTGCCGCGTGCAGCCTTGGAATGTTCGCGCTTACGAACGGGCTGATGTC
GTTTGCGCTTATGGACATGCCTACTTTTCCACGTCCAAATTCGCAAGTTATGGTGCAAACATGATGTTGAAGAAGCACATATGCACCATCTTGGACCACT
GCTCTAATGCGAAGGTCAACACAGCTGCAACTTGTGGTCGTAGTAGGTTTTCGGCAACTATGTTCTACTGTAGACTTTGGAACAGCTGGCCTGCAGGGCT
TTTAACATCAAGTATAGGGCTCATCTAAATCATGCTTGGTTGCTGACAAGTATTTCGAGTGTGGGGCTCTAGGTTGGACAAGGTATCGAGTGTAAAGCTC
AAGCCTGGTGCATGAAGGAGATAAATCGATGATGCGAATTAAGGTTATCTCACTGCGCGTAGTAGACCATGGTACGCGCTAAGAAAAGACGGGAAGCACT
GCTTAGCGTTTGACCAGGCTAAAAACTCACACAGGCTGCACACCCCACTATCACGTCAACAAGAATACAAAGATAGCAGCGTGTTCGTACTTTGTTTCGT
CGAAACGGAACGGAACTGGAATGGGCTGTATTAATGTTACTTCCCGAATTCCCACCAGCTTCTAGACGCAGATCGTAGATTTGCACT