Description :
Non Conding Region
Location :
contig_1:95071- 96513
Sequence
1442 bases(100 bases per row)
TCTGAATCAATCAAAGGTTGTCACTTGGGCCGGAATTCCACGAATGCCGAGGCGATCGGTGTGGAGCCAATTGGAACGGCCATGCAGTGTAGGAATCCTA
ATTGGCTGTCGCACGCCCATAATCTGCAACGCTTCATTGCCGGCATGATCGGGTTGGCGGTGAAGCTTTGGCAATTGAAGCATGCGACAGACTCGACCAG
CTGCTGAGGATTGCTGCATGAAAGATCAAGTTTTCTGAAGCACTGAGATAAGGAATTTGGGATCGTTATATAGAGAGCAGTTATAGTTGTTCAATAAGTA
GATATATCCGAGAAAATGTGAACATATATCTCAATAAACAGGTGAATCAATAGAGGCCAGTACACATGTTGAAGTTTTTCCGACCTAGAGTAATCATAGG
ATGCTGCCGGGCGGCGGCAACCTGCACATTGTCTTCAAGACACCACCTTGCCATCGCACCAAGGGCTCCGTTCCCATTAGCTTACCATTTGGCGAGCTGG
TCTCCACCCGATCCGATCGAAGAGCATGGCACAGCACAGCAGGCGCCAGGCAATCGGCAATGGATGTGCGATTACGCGGTACAGACTGTATCCCGTACTG
TACACGATTCTACTTTCTCGCCGATGTGCAACGGATACATCTGTGGGCACTGCTCCAAGCAGTGCTCGGCTGCAGCAGCAGTGCAGGAGTTCGGCCGGGG
CTGCACGGCGCTGCCTTTGCCCTCGCCATCAACAATGCTAAGCTTATCTAGACTTGGGCACTTGCAGTTGGCGACATCTGCAAGTCGCTGCAATGTAAGC
GTGACGAAGATTATGGCAGCTGTATTGCCAACGGCGAAACGCGTGACGAAATTCTACAGTGGTCCGTTCAGTTGGCTTGATAGCCCACGCTACGGTTCAT
TTTGTAGTGCATGCATTTGACGATGCTAGCCAGCCATTGATTCAGGTGACCGCTTTGACTCCGACTTGAGGTGAGCATCGCCATCGACTCACACCAGAAG
CTCCTCCTACGGTCGTAAGTGCTCGGACTATTAGCGAATTCGACAATGAGCTTTTTCAATGTCATACATGTAGCGAGCGACCCGAGGCGTTATCGGCACA
GTGTAGTCCCAATGAGCTCTCAATTCGAGTCGGCAATAACGCCGTTAGACGGCAGTCAGTCCAACGCATCAAGTAAACGGGGCGGCAGAAGTGGACAGGG
GCGACGCGGTGTCCGTAAAAAGCCTACTTAGTCATATTGGTACCTCATAACGGGTACCTACAATTCCATCTAACGATATTACTACTTGTAAAAGGCTACT
AATTATTCCAACAACCTCTTTCGTTTTCCCCCCACCTCCCAACAACACTGCCATCACCTTGATTACGTAATGTACTCGCATTTTAATCAATCTCAGCAGC
TGAACCTGTCAGCTCACTCTGGAATTCGATTTGCAGCGGCCA