Description :
Non Conding Region
Location :
Scaffold_1:95003- 95061
Sequence
58 bases(100 bases per row)
TGAAATAGTGTTTTTAGAAGGCCGGGCAAATCCATATTTGGAGAACAAGCAAGCGCGA