Description :
Non Conding Region
Location :
Scaffold_1:94969- 96216
Sequence
1247 bases(100 bases per row)
AAAAGCAGTAGGAGCGGTCAAAGGGTGAGGTCGCTGCACCACATTAAATCAGGATACACTTTAAGGAAACTGCCTACTTAGGTTTACATCCCACCCAACA
GCATTTTTGTTGTCTACTTAGCATGAGTTTTGCTTATATGTGCTTATTCCACGTAAATATATTTACCTATCGAACAGCATATACCCTTATTGTGTCGTTT
TGTGGCTTTTGCGGGTACACGTGTTGCTCAATTGGAGTGGGTTGCCCCTACCCCATGTCGCTCCTGCGCGAACAAAACCCGCCGCACGATCCGACGACCC
AACAGAGCGAGCGTCACAATCAAACGACCGAAGTTCCATTCTCCATTCCACCCCCGCGGCTGCTGCCACCGACTGCCGGCAAACAACCGCCGCTGCCAAT
TTGGCTCGCACGCCAGGCGACCAACGTTCCCTTACTGGACGTGTGGGTGTTCTATCTACTGCAAGTCCATACAAACTGTAATACAAGTACAAGAGGTCTC
TCCCAAATGCCAACAAACTAGTTTCGTATCCGTCGTGCGCTTGTTTTGCTGTAAGTATCGTCGTGTGTTGAGACTTTTTGTTTGCTTTTCGCCACCGACC
ACCCCCCTCTCCCTCTCCTCTGAATTTTTTTGTTCCCCACGTCCCATACAATTTCCCCTATTTATAGCCCATCCGCCTCCATCCCTCCCCCGTTTTCAGG
TTTTTTTTGATCCCAACAAACAAACAGCAGACAAGAAACAGCAAGGCAGGCAGCCGTATACACACAGACAACACCGTGCTGTCGTCGTCGCGTGCACCCT
CCACCACGTTGCCGCCCCGCAAGCGATCGGCTGCTGCTGTCAACTGCTGCCTCTTTTACAACGCCGCGCGTGCATTTCGGCTTGCTGGACGGACGGCCTG
ACGACTGCTAACGACGCGACGCTTGCGCTGTCGTCCGCACGGAGTCAATCACTCACGAGGAGCGACGCTCCGTCATTCCGCCATTCGCAGCATCTCTCGC
AGGGCCGAGAGAATTCACCCGCTTTTTGGTGTCCGCGTAGCAGCAACCACGTTGGCGTCACGCTCTCCGCTCGCGGCCTTTGCGTCCCCGTCGTCTCCGA
GTCGCGCGTCTTCCAGCAGCACGAGCGTTAGTGTCGCCGGCAGCAAGAAGCGCAAACGAGACGTGTTAAGTAGCAGTTGCGCCAGTCCACCGAGAGCCAC
TGCGCCGCCGTCGCCCTTTGCCACGACGCTGCGCATTGGGATCGACA