Description :
Non Conding Region
Location :
Scaffold_1:94673- 95439
Sequence
766 bases(100 bases per row)
TCACCGGGGACTCTAGAGTAGCTTTTGCTCTGGACCACAAGTGCCCAGCATTGCGACATATTAAGTACGAAATAGTGTAAGTTACGTAATTCCGGCAAAT
TACTCTCATTTACTCTCTTATTTAGATACAGCCTTTATACCGGACCACACGTCGGGAATACGCTCCGGTCCACGCAGCAGCGTGCAGTCGTCCGACAGGC
GCACCATGTGCACCGCCTACTCGTCAATCTCTCCAAACTGGTCGTTCAGCCACCAGTCCAAGTTGCTGCTCTTCTCCGGCGTCCAGAAGTCGTTGCAGCG
ACCACAAATCTCCCTCGAGCCTCTATTCATGAATACGGGCACCACGACCAGCGATTCGCGCCCACGTACACGTCCGGCGCGAATCGCTGGTTCAGTTGCA
CCTCGGCAAAGCACGCCTGGAACGTCTTGTAAATTTACAACGTCGAGAAGTCTGCAAAGCCGAAACCCACCTGCTTCTTCACTTTATACACGCGCTCAGG
CAGCCATGGACATGTGCGTGTGCACTACACGCATGACTTCTGTACTACCGCCGCCGACGCCAGCAGGTGATACCGTTAGAGGCCTCGCAGCAGGAATTGG
AGCGCGCATTGAAGGACAATTGGACGTATGTGTTCTTGCTGAGCGAGCAGCGTTTCCTGACGGCTCCATTGACGTCTTCCAGCACTTCAACTTGTCTAGT
GCCCTGTTTCCCTCGTTTCAGTGTCACATCCCCCTCCTTCAATTAGAAATCTGGAGTAATCAGAGA