Description :
Non Conding Region
Location :
Scaffold_1:94641- 96914
Sequence
2273 bases(100 bases per row)
TCTGTGATGGCACAACACAGAAGCAACGACGGTTAACCTAGACTGATCGCCAAGGACTTCCGTCGCCTCGACCCCGTGCGGCGCGAAGCACACACGGAGG
AGTGACGGATCCTCCACGAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGCGCGGCCTCAGAGGCCCACGTCAACGTGCTGCAGCGCGGCTCCTAC
CCCGCCCCGCGCGTTGCGAACAACGACGCAAAGCGGAGGACATGCAGCGGCTCTCGAGGACCAAGAGCGCGACGCCATGGCGGCTCGACGTACTTGCTAG
ATGGGGCTGGACCGGTCGGAGGATTCGCAAAATGCTGCCTAGGCGGGATGACGGGCACAATGACTGGCGGCTTGGTGGTGGCCAGCCAGTCAATCGCCGA
GCTGATGGTGGCAGGAGCGGCTCGTAAAAAAGGTGAAGGGGTCACGGTGTGCGTAATTACTCAATTATCAATTATGCGTTTCATCCTCACACAATTTTGT
CATCCACTCTAAATATACAATTATTACGAATGATTATGACAGAAACTTTCTGCCGTAATCCGGTTTGTGCCAAAATAGGGTGCAGCAAAATCAGCCATCA
TTCCCCTCAGAGTGATTGTTTCCCATGTTGAAGCGATCACACCTCTGCATCTCATTTCTCAATCTCTCTGCAACGTGCCACGCACCAACCACATACTACC
AGCAACTCCGCCGTGATGCCGCTCTCATCGTGCAAGTTCTACCAGTTCGCCATGTCGGGCGGCCGCTCGAGTTCGGCCGACGCCACGCCACTGCGCATCG
CCATCATCGGCGCTGGCCCTGCCGGCCTCGCACTCGCCCGACTTCTACAGAGCAGGGAACGCGAGCTTCTCGATAGCGAACAAGGCAACGGCGGCAGCTC
TGCGCGCGTGTTGGACGTGGCTATCTACGAGGCTTACAAGCTCGGCAACGGGACACGCGAAGGCGGCTCGCTGGATCTGCGTCAGGGTACAGGTCTGAGT
GCCATGGAGGCTGCCGGCCTGATGGACGAGTTTCAGTCGTGCGCACGCCCGGACGGCCAGGATCTGCGGGTGATGGATCTGCATGGCGAGGTGCTGTACC
GCGAGGACAGCGCCATCGACGACAAGAACGAGCTGTTCCATCCGGAGATCGACCGTGCCGACCTCAACCGCATTCTCCGTCAATCACTCGAGCCGAGAAC
GATCCGCTGGGAACACAAGCTTGAGAGTATTGAGCGCTTCCGCGACAAGCATACCCGTACCAAAGCCTTCCGTCTGATCTTCGACAATGGAGAACAAGCT
GTTGCAGACCTCGTGGTCGGCGCTGACGGCGCGTGGTCCAAGGTTCGGCCGCTGCTGTCTCAGGCGGCACCGGTTTACAGCGGGACGACATTCCTGGACT
GCACGCTCTACGACTTTGACGCGCGATACCCGCATCTCACCGACTTTGTCGGACGCGGGTCGGTCTACGCGTTCAGCAACGGGAAGGTGCTGTTCACGCA
GCGCAACGGGAAGGGTATCTTGCGCGTATACCTCGGCTTCAAGGCGACTGAAAAGTGGCGCGAGAACTCGTATACTTCGCTAATCGCGACTGACCCAGAG
CGATCGGAACTGCTGATCAAAGAGTACTACAGCGACTGGAGCCAAGAGTTCCAGCAGCTCATCAAGGCCGCCGGCGAGCAAGTCGAGTGGCGGCGCAGTC
AGGGCCATGAGTACCCTGACAAGGCGACCGAGATGGTTGTTCGACCACTCTACGAGCTGCCGGTCGATCATTCGTGGGACAACCAAGACGGCGTGACGAT
CATCGGCGACGCAGCTCACCTCATGTCCCCCTGTGCAGGAGAAGGGGTCAACATGGCAATGGCAGACGCCTTGGGTCTCGCTGACGCCATCGCCGGCGCG
GCCGACAGATCGGAGCTCCAGTCCACGATTGGCAAGTTCGAGGCCGACATGTTCGCTCGAGCGGGAAAGGCTGCCGGTGTGTCCATGTACGCGCTACGCG
CCTTCATGGTGAACAAGGCGGCTTCGCCGGCAGACGCGGCGGGTCTTTTCGACAGGAGCAAGCACTGAGTTTGAGATTCAGACAGTAGCACATCACTCAG
ACTTTGTCTTGCAGCGCTGGACAAGTCGTCTTGCATATTGTCCACCGAGTTGCCTCTTCGATATCCATATGGACACCCCATGTTGAACATCATATGACCA
GTTCAGATACTGTCCTCCCATGGACCATGTAGAAGTTGAATGTGACGAACGAACTGCAGCGAAACAACACAGC