Description :
Non Conding Region
Location :
Scaffold_1:94640- 95640
Sequence
1000 bases(100 bases per row)
TTCTGTGATGGCACAACACAGAAGCAACGACGGTTAACCTAGACTGATCGCCAAGGACTTCCGTCGCCTCGACCCCGTGCGGCGCGAAGCACACACGGAG
GAGTGACGGATCCTCCACGAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGCGCGGCCTCAGAGGCCCACGTCAACGTGCTGCAGCGCGGCTCCTA
CCCCGCCCCGCGCGTTGCGAACAACGACGCAAAGCGGAGGACATGCAGCGGCTCTCGAGGACCAAGAGCGCGACGCCATGGCGGCTCGACGTACTTGCTA
GATGGGGCTGGACCGGTCGGAGGATTCGCAAAATGCTGCCTAGGCGGGATGACGGGCACAATGACTGGCGGCTTGGTGGTGGCCAGCCAGTCAATCGCCG
AGCTGATGGTGGCAGGAGCGGCTCGTAAAAAAGGTGAAGGGGTCACGGTGTGCGTAATTACTCAATTATCAATTATGCGTTTCATCCTCACACAATTTTG
TCATCCACTCTAAATATACAATTATTACGAATGATTATGACAGAAACTTTCTGCCGTAATCCGGTTTGTGCCAAAATAGGGTGCAGCAAAATCAGCCATC
ATTCCCCTCAGAGTGATTGTTTCCCATGTTGAAGCGATCACACCTCTGCATCTCATTTCTCAATCTCTCTGCAACGTGCCACGCACCAACCACATACTAC
CAGCAACTCCGCCGTGATGCCGCTCTCATCGTGCAAGTTCTACCAGTTCGCCATGTCGGGCGGCCGCTCGAGTTCGGCCGACGCCACGCCACTGCGCATC
GCCATCATCGGCGCTGGCCCTGCCGGCCTCGCACTCGCCCGACTTCTACAGAGCAGGGAACGCGAGCTTCTCGATAGCGAACAAGGCAACGGCGGCAGCT
CTGCGCGCGTGTTGGACGTGGCTATCTACGAGGCTTACAAGCTCGGCAACGGGACACGCGAAGGCGGCTCGCTGGATCTGCGTCAGGGTACAGGTCTGAG