Description :
Non Conding Region
Location :
Scaffold_1:94590- 94870
Sequence
280 bases(100 bases per row)
AAGAATTACTAGAAGATGGGTAGCGCCGCAAGGCTACGACCACAATTGCATGTGCACATTGGCCATTATTGCTTGGAAAGCTCCCTGTCTTGGTTGAGTT
TTGTGGAGAGGTTTCTGGAGGAAGCAGCAATTAATGACATCAATACAGAGCGTAGAATTAATCAGCCAGTAGTTAGTTACCTTGGAATCGTTTTTCATTT
TGGATGCGACTCCACGACGAACTTGCCATCAACAAGTATAGGCACGCCGCCTCAAGGCATACGTGCATGATGCGAATGCC