Description :
Non Conding Region
Location :
Scaffold_1:94574- 94731
Sequence
157 bases(100 bases per row)
TCTGCTCTCACACAGAGATAAGTTGTCTGCAATGTAGGGGCAATTATACACACTTAGATCCTTGCATGGACAAAAGACCCGAATTTCACGCGAACCAAAA
TGCCACCTTCATTTTTACCTAACTGCTGATCGTCGACACGACGCTGTTGGTAGAACT