Description :
Non Conding Region
Location :
Scaffold_1:94573- 94938
Sequence
365 bases(100 bases per row)
GCCGTAACTCAAGTTGGCGAAACTAGCGACTTTTGCATAGAAAGGTGATTCTAATCCTATTTTTGCCGAATTCATCGCAATAGCAATGCACGCGATGTCA
TTCTTTCAAGAGTGTAATTGTGTTGACCACGTATCGGAGCCAATTGCGCTGTATTCAGGTTTGTGCAGTATAATCCTGGCCCATTGCGTTAGACTACCCC
ACAAGTAAGCACTTGGTTAAAATTGCAAGTGATTGTAATTGCGTAAAGGAGCTTACTATCTGATGCTAACTGTTAGTGTTATTTGTTCGTGTGCTTTTGT
TCTATATTGCTTACTCGTTAACAGTCTTAGGAGTTAAATACATCGTAATCTCTGTACTAGAGAAA