Description :
Non Conding Region
Location :
Scaffold_1:9450- 11815
Sequence
2365 bases(100 bases per row)
GCTTCACTTTGATATCTGCTTGTGCCGACCAACAGCGCGAACAGCGTCAGCGANNNNNNNNNNCGCGGTCCGCTTGGCGACCAATCGCCGCCGAAAGTCG
GCCACAACCCGCCAGAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCGGCATCTCTCTTTGCGTGGCAGGATCTCACCCATTCGCACAACGCGTGGGCGGCGACTCCCAGCTC
GTGGTGATCAGGGACGTCTGTATTGTGAGCCATTTTCGCTAGGAACGCTCGACCGTTCGAGCGACTGGGCCAACGCAGCAGGGGAGTCCCTGGTGCAGTG
ACGTGCCCACTGTTGGGAAAGGCAGCTTCATCATTGTCCACCGCGTCACGTGGCGGTATCGTGAGCAGGAAGCTCGGTGTGCTAGTGATTAAATGGCGGA
ACAGCGAATATGATGGAGAGTACGAAACAGTCCTGATGAGAGCCGACCCAGTCACGATGCTCTTGTGGATGTAATCTGATGATATGCCGCCGCCAAAAAG
CAGTGACGTGCGCCACTTGTCGTGGGGGATCTCCACCTCGTCGCGTTCTTTGCCAAAGGAGAGGTGAACAAGCGGTCCCCCCAACGTGATGGTCACGGCC
AGCTCTGCACAGAGCATCGCGAGCTCCTTTTCCAACAAGAGAGACCAAGGCGAGTCGAGCGCATCGGACACGTGCAGACGGGGCGTCGTCGCGGCGCTGA
CTCCGGCAACGGATACACGCCTGTCCGTAGTGGTGCCTCCTGGACGTTGCTTGACTGTGCTGGCCACGACAGCGGACGCCGTCAGCGTCTTGCCCAAGCG
ATGAGTGACGTCATTTTCGGCCGCGCGTTTCACGGTCGCATTAGTTGCGTTCCATTTTTCGAGCAACTTGAGAAGAGACTGCAGCGGCGTCGAGAGAGTC
ACAGCAAACGCTGGGATACTTGTGAACGCAAACAGGCCGCTCACTAGCAACGGCAGCACGCGTCCCACGACCGACCGCTCGAGTGTGTGGGCGACGCGCT
CACCAAACGCAGGATCGGCAAAGAGATCATTCTTGCGACAGCACCTTCGATTTCGTGAGGATGAGGGTGGTGATGGAGGCGAACTTGGATGGCTTCGCGA
CAACACTTGTGTGAGGACATCGCACGACTGGCTGAGGACGCGCAGCGTCAACTGCAACATCCCTGTCCAGGCGACGGGGAAATCATCCACAGCCACGTCG
TCGGTATTGCCGTCAGAGTGAGATCCGACGCGCATCACCGACGCTGCCACACGCGAAAGCCGAGCAGAGAAGCTTGTCTCCATGTCCAGGACCAAAGATC
GTGTCCACTGCTCGCAGCCTCTCGCCATTGAGCCTACATGCTTTTGGATGACGATCAACACGTTCATGGTCGAATCGTTCAGTTGAGATTGGTCGGATCG
CGTGGACGGTATCGTGTTCGGTGCGTCGTCGTCACGGGACCCATGCGAGGCCGCAGTGAGTTCACCAATGGTGAGCATGAAGTGCCTGTTCAGAGACTCC
AATAAAAATTCCACGATTGTATCGAGTGCCTGGAAACGCTTTGGCGACAGCGACGATGCTGGAGGTGGGTGTGGGTGAAATGAACATGCCCTTGTGACTG
GGAGAAACGTCATGATCGTCGCGTCATCTGCGAGTCGCTTNNNNNNNNNNGATGAACATGCCCTTGTGACCGGGAGAAACGTCATGATTATCGCGTCATC
TGCGAGTCGCTTCAGTAATGCTGATAGCAACGGACGTTTCGAGATATTCTTGAGCACTCGCAGCGGTGTCCACTCGATGGACTGGCAAACTCCGCACACT
GGACGCCCATCATCCTTTGATGCAGACCCCATCAGGCTTTCCAGCAGCAGCACACGAGAACACTGGCAGGGGAAAAAGACTTCGAACCCCAGCATGAGAG
TGTCGATCGCCTCACACACGGCGCGTCCGCTTCCTGCCGCATAGACGGATGTTGTATCCCTATCCGAATTCGGTCCGTTGCGGTGCGAAAGTCTGGGTTT
GGAGATGAAACTCAGTAGGAGCGTGCGTATTTGACGCATCGATATGAGCAAGTCGACGACGTCGGAATGGCACTCACTGGTGTTATCACCTCGTGGAGGG
CACAGTGCGGGTTCGGTTTGCTGCAGAGCGNNNNNNNNNNATCCGATTTCGGTCCGTTGCGGTGCGAAGGCCTTGGCTTGGAGATGAAACTCAGTAGGAG
TGTGCGTATTTGACACATCGATATGAGCAAGCCAGCGACGTCGGAATGGCACTCACTACTGTTAT