Description :
Non Conding Region
Location :
Scaffold_1:94484- 94537
Sequence
53 bases(100 bases per row)
AGATCAAAGAACGCGCGAATAGCACTCAAAATTATGCCGCAACGAACGACACC