Description :
Non Conding Region
Location :
Scaffold_1:94399- 94734
Sequence
335 bases(100 bases per row)
GTTCGATCCCTTCTCCTTCCCTCTTCAAGCTCGAATCCTGTTTGAAGGGGACCGGCGTTGGACTTCACCGGAAGGATGGATGACATTTAAGGAGATGGGA
TGCACAGCTCTATGTTTGGTCTTTCTTAGTGAAATCTAGTGTAAAGGGGATTTTGTTGGGGGCGGAAAAAAACCTGAGTCAGGTGACAATCTATAAGGAT
CAGGTTGAAAGACCGGGTGTCAACTATATGATCTTCGCTGTGGAAGAATGatggttgaagtggtctAGCCAATCAGATTGAATATATCTTTGCTGTTAAC
TGTCCGTTATCCTCAACGGATATAACCAATTTTAT