Description :
Non Conding Region
Location :
scaffold_1:94287- 94978
Sequence
691 bases(100 bases per row)
GCGCTCGTCCTGAAGGACGGTGAAGCTTTGGAAGTGTATCTCCTCCCTATGCTCTCTAACCCCGTTCTGAATCCAAGAACGGGGTTAGAGAGCATAGTGG
ACAGGAACAAATGCTGGTAAAAAGTGATTACGGTTATATATCAACTTCAACTTTGGAAAGTATTTATATGTTTTACTTCGAAGCAATGTTATTCCTGCTC
AATCATTTCCAGCTATCGCGAAGAAAGATAGGCATGCACTCTCCGCTTATCATATGCCTTTCCGACTAACTGAGGCTTTCAAAATAAGCACAGGAAAGGA
ATGAGTACAGGTTCAACGCGCCATGCCGATGCGATGCTTCAGCCCAGCATTCCTATATTTATCAGTCCATGTCGAAGTCCATTTTAGATGGAAAACTCCA
GCTATCTATGGCGTCTACCATCTTGTCTTGCGTTGTCCGTTTTGGCCAGCTCATTCTCGATTCGGCTTCAGCGAGACCGCGAGCAAGAAGACCGAGATCA
AGTGACTGCTGCCAGCATGCGCTATTGGGAGGGACTCGCGTTGCTACTGAGCACGACGATGGGGTGGAACCCCGTTGTCGGGACCACAACCACGTGGGCA
ACGACTTGCTCAGCCGCGGCGGATCTGGTGTGGCAGGGGACTTGCCCTGTGCGTACTGCGAATAACACCAACTACGTCTCTCCATCAGGAA