Description :
Non Conding Region
Location :
Scaffold_1:93883- 94849
Sequence
966 bases(100 bases per row)
ATGCCTTGATACTCTTGTCAGCGTGAGTCTTGTGCCAAGAAAAACGTGGCGCGTTGATGTGCAGGTTCGCGCATGTTGAAGTTGACGGACGCATTGCGAC
TTGTCCTCGCAGCCTATCCTGGCAAGACGACGTCCGTCGAAGCAGAGCATCATTCGCGAGGGCCGCACCCGTCAGCTGTCCCGCACCCACGTGCGTACCA
TAGCGACGAGTGCAATTGAAGGGCACACACGGCGCTGTCGCCGTACAGGTCGATCGATGCGCACTTGAAACGGAGTTGATACTTGTTTTATCAAGCACGC
ACAGGTCGCTCAAAGACAAGCCCTTGACGTGCAAGGGACGTGGCTTCCTCGAAGCTTCCGCCCCAATATTTCGCCTCATCCCGCTTTCTGCAGCTGCGGC
CAAATGAAGTCGACTACCCGACCATCATCACGCAGCACGCAGCCACAGCCGCTGTACAAGCAAACGCTAGTGCCTATACGACTACTACGAGATCCAGCGG
ACCGGGTTTGCAGCTCGTACTGGGTAATGATAGGGACCACCGTGTTTCTGTGTCGTCACTGAAAGAATGCCACGATGGACAGCGTTTATAGATGCTGGCA
ATCCTCTAGGACCAAGACGGAGCGTCGCGTCGACGCCTCCGTACTACTCTTGCCACGGCCGACGATGCAGGGTGATAGTCCGCACTCGTGTTGGGTGGTG
CGCCACAAATTTTAAAGTCGTCTTGATGTCCACACATTGCAGTCTTCACGCTGCTCTCGATTGGACGCCGTCGACAATGTCCTCGATCGTCACGAGTTTG
CACAAGTCGCCGGGCGTACCTTGTATACATGGGCCTCTCACGAGCGGTGGGAAACGCCAGCCGGCGAACCGTCTATGGTTCAAGAACTGTTGGCGTCGTA
CAGTACGCAGCGCAGCTGGCGCCGTGGGCACGCGATCGCTCGCAGTCGTATTTCGAAAAACCAGCA