Description :
Non Conding Region
Location :
Scaffold_1:93882- 94105
Sequence
223 bases(100 bases per row)
GCGGCGGGGCGAGGGGCGGAGAGCTCCGGCAGATAAGATAGTACGGCTCGGCTTTGGGATGGGTCTTCCTGCAACAGAGTCGCACCTAAGTGGAGACTGG
TGTGACGTTATGTGACGTAGTGTGGCACACACCAACTGATCCACTTGATGCTCTTTTTCTTTCGGAATCAGTTGGAGAGATCTCGAGCGAGCAGCTCCTT
CATCCCCTTGGCCTCTGTGACGA