Description :
Non Conding Region
Location :
Scaffold_1:93860- 95302
Sequence
1442 bases(100 bases per row)
TCCACTTGCGCCATGTGTATATTTCACAATACCTATTTAGTTCACAGTTCTTTATCGTACATATATGTGTGGGGCTACCTGTACCAGCATTCAGCAATGT
TCAATGACAGTTAGGTCCGTCAACCGCCCTTTGTAGTTTAAGTTGTGTACTTGCATAATATATCAAAAACGCATATCTTGTCCATCGAAAAACGGTCGTT
TCTCGTAAAAAAAGTAATTACATATCGTGATATATATAAATTTATTCGAAGAGGGTGATCTTGTCCAGCGCGACGACGGCAGGCAAGTCGCTGTCCAGTA
TATGAAGCTTGCTTTCAGCCCACACTGGCGCCGACGGCTAGACCAGCGCCGCCATGAGAAGGAGACTAGTAGTACTAGTAGAAGTAGTCGACACCGACGG
TTTGGTCACGGAGGTCAGGATAGCTGTGGCGGCGGCCGAGTCCATCCACGAGCGCGCCGCGTCGGGGCCGCAGACGGCGACCACTTTGTGCAACTTTGCC
ATCCAGTAGCGACGACAGGTGCAGCACCGTCTCAGCTTCGACGGGAAACAGCAGCTACGACATGAAAACGATTGACCCATTCATCGTGATATATGGAGAA
AGTATGATCAAAATCATCCGTTATCAAGCATTGCAAGAAAAGATCGAGGCACCGTACTTTGACTTGGTGCATGATGCGGTAGTACATCGAAAACGCGTCC
AGCGTGGCCCTGTGTATATCCGAGTCATCCTCTGATATGGCAACCAACGTATTTTAATGACTGTTTCGTCGTATATATACTGTATATATATGTATATCAA
TGGTAATCATCGTAGAACACTTGTGTAAGTTAGTGATTGGAATGCTGCTGTCAACAGAAATTATTTACTCACGACTACGTACATAGTAATATTATCCAGT
GGAACTATCAATTAACGTTGCTCTATGCCAAGTGCACTAATATACTCAAGTGCATAGCATACTCTTTCATGAGCCTATCTATTTGAGTGTTTAGGGACGT
CTGTCTATTGAGGAATCGTCTCCACTGAAATGGACGAGGATTTCAATAATACTAGGTACTAGTAGTACTACTAGTATCCATGTCGCGCTCGTTTGGAAAG
TACGTTCTGGTATGTCATGTCGCCTACAGTAATACTATACGAGTATTGCCCTTTTACCCAAAATAAGCCAAATCTATCGATCGATTCTTTATACTCAATG
TTGTATGTTGTCGTCTTATAATCACACTAATTTTAAGTCACACACTAATTAACACACATATCAGCTTGTACAAACTAACTACACGATACAAAAGATAGAT
TAGTAGATACAGTATCTGCGTTTGCCCAACTGGGCCAAATCAAACGTTTGGATTGGCAGAAATTCCCCAGACTGTGATTTGATTGGCTTGGTATTACAAA
TCCATTCTCTCCAGACATTAGAGGCTCCAGTTTCGACTCGAT