Description :
Non Conding Region
Location :
Scaffold_1:93789- 94768
Sequence
979 bases(100 bases per row)
CTGATTGTGTTGTGTATGTGGCTGTGTGGCTGGTGCTGGTGGTGGGGAAGGGGGTCGTGGAGCGAGGCGATGGAGTGCCGCTCGTGGAGCTTTTCGGGGA
ATGGCTCATATTTGTGCTGGGCGGATCTCGTGGGTGGCCAGTTTATACGCGCTTCAGGAGCTGAACACACGACCTGTGTAAATCCATACCCTCTAATAGA
AAAGTAAAGTAATTGACATTCGTTTGTTTAAATTTCCTGTATTACCGTATACCCTTCCTTAAACGATGAGATGAATGCATACCGGATTTGAGAGGGTGAT
GGTGAATGCGCAAATCCAAGCCAGTCATATGATCAACTCGATCATGCGCCTGGCTTGGATTTGCTCCATTGATCACAAGAAAAAGCCCGCAGCGTCAAGC
GTCGAGCGTCATCAGCGCCAAGCAGCAAAGAGACGAAGCGGCGCCAGCAACAGACTGTAAGCATGGCGCTGGTTACATAGCAGAGTTCTAGCAGCCACCC
GTTGCCTGTGGTAGTACAATGAGGTCGCGTCCACTGTGTATGACCCTGGCCCGCCGCACCGGAATACGAATTGTACATGAGCAGCTCCATAGACGCTGCA
CTGGCTGATGCGAGCATTTTTTTTCTCTATGACTGTGGCTTAGTTTATGTAATAATGTATGTACTCACTCGTCCGGGACGCTCGAGCGATAGTTGTGGTG
GACGTTGTTCGGGTCGGGGAAGTTGACGAGGTACCGCCAGCGGCTCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTAAAGGATGCCAAGTGTGCAGAGCACCGT