Description :
Non Conding Region
Location :
Scaffold_1:93711- 93984
Sequence
273 bases(100 bases per row)
ATTGTCAATCCGCCTGAAAAAAAAGGTTGCAAATGATTAGTCAGAGAGCCTCTTTGATTGGCTAAAACCGAAGCTTTTGTTTACGGTGCAAATACGCGCA
TTTGATTCGCTATATGTACATTTCAATTGGCAATCATTGGTCGAAAAATTTCATTTATCACCACTCACATCTCTCGGAGCAGGAATGATTGTTACCCGGT
CATTTGTGCGCCAGAACGATCGGTGTCCATTCTGAGATTTGCCCCGCGAACAGATCGATCTCCGTGTTCACGA