Description :
Non Conding Region
Location :
Scaffold_1:93709- 94179
Sequence
470 bases(100 bases per row)
GGCGCGCGCCGTGCTCGCCCGCTGGCTGGCTATCGCGTGGCTCGCAGGTCGGCACCGGCGCGGAGCGGGGAGGCATCCACCCGTCCTCGGACGCGAAGAG
GTAGGAGGAGGAGGCTGTTGGTGTCGACCGGGGAGAGACCGGAGGTTTCGCCCGATAGCACTCAAGCTGGCTGCGTCAGCCCGCCAGCGTTCGCTCGCAT
CGACGGTGGGGGCCACCAAACACACCTTTGGGATCAACGAGTCGTTTCGCTGCGCTCGTCGCTGGGCAGGCGGCTAATTATATTGTCAACAGGGGACGAC
GATGAGGCCGTTGCTATGGTCGAAAGCCGGCGGCAGTCAAAGAAGATAGCGGTGAACGAAGCGAGTCGAGAAATGAGAAATGTGTCGAACCTCCGCACAA
GCTGTGCTGTGTGTATTGGCCAGTTAGTTCCTCCTCATCCTCTAGCGGTCAGAGCATCGACGTGGCGACT