Description :
Non Conding Region
Location :
Scaffold_1:93306- 93445
Sequence
139 bases(100 bases per row)
CAATTCGACTGCACTGCACTTGGAGCGAGTATAGTGCTATGAAGAAAGCGCTAAGTCGCTTGTTGTCATCGCTGGAGCCTTGTGGGGCCGCAGCACGTGG
CAGATGCCACGTTGAAAATGACCGTATTTTCAAAACGCC