Description :
Non Conding Region
Location :
Scaffold_1:93098- 93464
Sequence
366 bases(100 bases per row)
TTGATATGTATGTATATATGTGTGTGCACTGGTCACCCCATTGGTAGGTGAGGCTCGATGCCTCATCGTGCAGCAAGTGACGACGGTCGTGAGAGTATGG
CCCAAGTCTGAACTGGCCGAGCACTGCGACGATGTGCTGCTCCTACTCACTGGCGCCATTCAAGATCCCAAAGACTTTGTTCGCGCGGTGGCCCGCGAAG
CGTTGTGCGCGTTTGCCGAGACTTGGTACGGTCCAGTCTACCATGTCGTCGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAGAAACAAA