Description :
Non Conding Region
Location :
Scaffold_1:92909- 97229
Sequence
4320 bases(100 bases per row)
GTATTATACATGTACGAATAACTCATGCATTCCGTTGTTTAGGGTAGATCAGGTGACGGATCCTCAACAGAACTATCCCCCCATGAGATAGTTGGTGCTG
CCTTTGGGGAAAGAAAACCAAAGGTACTTCGCTTCATCATTTCTACCTCTGTACACATCGCAGGCATACGGTAGAGCTGTTTGATCAAATGCAACTCTCA
AATGGACGGCAGCGAGATAGAGTGAGCTCCGGGGGTCAAGTCGGACGGGCGAGATCCTCGGCAACTCAAGCACCGCACCACGCTGGGTCGTCAGCTGCTA
CGCTAATATGCAAAGATGTACTTGCTGGTAGGCGGATGGTCAGTGTAACTATGACAAAATGTAATGCTCACAGAAGGAGGAGAGACCAAAACGGTCCTCG
CTCCTTTCACGAAGTACGGAATAAGTTATCTTCACTCCATCGCCAGCGGGTAAAACTCGCAAAAACTATACACATCGAGAAACGGCCGATGCCCTGGTGA
AGGAAATTCGATACTGAGAGCGCTATCGAGCCGGCGGCATTTCCAGTGGACGGGAGCGCGCTTCGCTTGACTTGAAATTTGTATGCTTCATATCCTTGTC
TGATTGGTCAAGTATTTACGGATCGCTGATTCGTCAAAACTTGCTACGATCTGATTCGTTGAAAGCAGCAGGTAAACTTTACACTTTTTGTTTACCTTTG
TGTTACGCGCGATGACAGAAGATCGGCTGCAGATACTCGACGTTGACGTGTCTGTACACGCTCCCACACGCGCGGGGTCTCCGAACCAAGGCCGTGACAA
CCATTGCATTGCTGTGTGCGACACGACCCGCGCGATTGCCATAGTCAACGGTCGCTTCGTCGATTTGTATGGCGACAGCAACAACAGTTTACATCCGCTC
ACGTTCCTGCACCAAATTTCACTTGCAGACCACGCAACTCGCTCCCAAAGATCGTCATTTGGCCGGCAATTCAGCAGTGATGAACTAGACTGCAGTGTGG
TGGAGGCTACGTGCGTAGCGTTTCCTGTTTCTGGATTTCTGCTTGTCGGGGCTTTCGTGGAAGTTCCAGAAACTGAAGAAGGTGACGCGGTGAAGTCGTC
AGGGGCCACTTTTCTACTTGGTTTCCGGTTGTATCCTGGTTCGGTGTCTAGATTCGTTGGTGTTGTGGATGGATCTACGCCTCGGCAAGCGTCGGCATCT
CTGCAGGTTCATTTCAGCTTCATGGAACCGATTGTGGGGAATTTGGGGAGGCGTATTCGGTGTCTGCAGCCTTGTCGACGTGAGATGACGCCGGATGCGG
GAGCTGTGGATGTTCTCTTTGAAGAGTCAAATTTCATTGGCGTGTTTGCCTGGGGAGAGCGGTTTAGCGACAGGCAGGTTTGCTTGGCGCAGCTGAAGCA
GCGACCGGAAAAGTTGGTGGTGGCAGAGCGCAGCTGTGATGGTCGATACCTTCTTGTTGGAGACGCTGGAGGGAGGCTGTCGCTGCTTGACTTTCGGGAT
TGTCCGTGGGACGGATATGGAGTATCGTCGGAAGCGCAGCCATTACGAGGCAAGCGACTCGACCTTGGGGTGAATTCCCGCTCTGGAGTGGTAACGCGCG
ACAACTTGCTTGAACATGTGCGGCTTGTTCATGCAACATCAACCTCTGACTTGAGCTGCGCCTACACAAGTCTTCGCTGGTGGATTTGTGGCCCACGCGA
TCAGCAGAAGCAGTTAGTCCTTGCCGGCAAGCAAGATGGGTCTCTAAGTGTAAGTTAGGTGTCTGTCGTAATTGCGGCGCGTATTCTGAAGAAATTAACT
TATTCTTGTGGTACCAATTTGCGCAGGTGTTCAAGCTCATCCAAGAAATTACCGACGCAAGTTCAAGTGTCGAGCTGAAGATGATTCAGGTTTGTAATGG
TGTGTACATTGTTTAGATCTCGATATAGTCCTAACCGTGAACGATTCTCGTCGTTTGCATTGCCGCATCAGATGTACCCAGGGTTGGCTTCAGGCACACA
CGATGTAGTACGAAGTATTTCAATGTCAGTTAAATCTTCATCCACTACAACGGGTGACACCTGGTTCGAGTTTAGCACGGTCTCGGAAATGCGTTGGAGA
ACATGGCGAATAAAGATCGAGGATGGTGGAGAAGATTCGCTCAGGCGATATCGCATGGTTTGGCCGTCACTGAAAGAATCGCTTGAGTTTCCGGCGTTCA
CGGTAGGTTTGTTATATTGTATTTGATACGATAGAGGAAGATTGACCGATTCGGTGTGTATAACTCACTGTAGCTTCGACTCAATAGGATCAAGAGTATC
ACTATACTGCCTAGTCATGCTGAGGTGTCGAAGTTTGTCGCCAAAGCACTGTCGGATATAGTTCCAGGTCAAATTACTCGGCCCCCAGTCTTGTTGATTG
TAGCTGAAGACCGTCTCCAAGCCGTCGGTTTGTTGACGAAAGCCCCAGTTGCAGCGGAGGATGACTCGGAAACCAACCTAAGTGAGAGAAGTGGTTGTGA
CTACAATAGTGAAGAGAGGGAGCGCCACGAAACCCAAGAAAAAGAGGAGGAAGAGGAAGAGGAGAAGAAAGTATCCAGCCTTGATAACAGCCAAGAGGAG
AAGCGCGACGCTGGCCCGATGACAATTCAGGACAAGTACAAGCTTCCGCCAATGGAGTGGAAAGCGAGGTCCTCTGCACTACGGAATGCTGGCCAGAATG
GAGATACTCCTGGTCAGGTCGATAGGGCACCAAGCACTTCACGAATGTCCAAGCTCAGTCGAGACGACTATAACGAACGCGTTGCTTCCGTCGTGCAGCG
TGTCGAGACTTTGAGTGGCGTCATGAAGTCGATGCGAACGTCTTTCCAACTCTTTTCAAGCGACGTCCAGCAGCACATGAACCTCATTTCGGAACAGCTC
GAGGAAATTAGTCGCCGACGAGTCACGGAAGAAACGGCCCAAGCTTCTCGAAGCCGTTGAATTTAACATTCGGATCAACGAGGTGGCCGCACTCCGAGCC
GGAAGAGATCATGGAGAAGAGCTTCCTTCAGGCCCAAGCTGAAATGGCGCGCTTCGATGCAGGACCTACAGAGAGGTCGAATAACCAGACACCGTCACCT
GTGATCCCGCACGTGGTGGACAAGTACGACCCGGACCACCCAGACGCAGACTGGGGAGGCTACGTGCGCCGTTCAGCCAAGAAGCGCTTCTACACGAACC
AATCCTCCGTCAAAGACGTAAGATCTATTGAGTATTGGGGGCTACATGGTCACCAATGGATACTAAACGTCTGTCTACTGTAGAATTTAACCTACGACGA
GAAAGGTGGCATCATGCCGCGTGACGCGGCCGGCAGCTCCACCACAGCAGGAAAGAAACTGTTTGAGCCTCAGCAAAACTCATCAGGTGATCAAGTCCCT
GGTATTCCCTTCCAGAGTGCTGTCTATCAGGTAGATTAAATCGCTGTCCCCCGTGGTTCAACGTGTGCTGATCGCTGTGCTTCTGTAGGTCGGTCCAGGG
AACAATGTCAGTTGCAGTGACTGGAAAACGTAGGTGAACGCTGCAAATGCTTAGGAGGATGAGGCTGTATATTCACATTTGTTTTTCAATGCCAACCTAG
ATCGTACGCGGCGCAAACGTCGATGGAGTCGACGCCTAAAGACAACTACGTGCTGGGCACGCGGCAGAATTCGCAGCCTAAACGCCATGTGACTCCAATG
GTAAAACGTCGTTGAGGGGATTACACTGAGCGTATAGTATATCTTCTAACCCCTCTGGTTAGTATGAACAAGGTCGAGGAGGACGACAGAATTCAGCACG
GACCCAGTCTCCTTCAACTCCTTGGGAGACTGGTCGAGGCGTGTCCCCACCATTAGGCGCAAGTGGTAGCAGCGGTTCGCTTTCTGGTCGTCGAATTGAT
TCGCGTCGATCCCTACTCGCGGGCATCGGAAAACTCGTTGCAGCGGAGGATCTGGGCGGAATACTTCCGTAAGTGTTCGAGTTGTCCATTTCATCGTATA
CAAACGGAAGCTGAACGCCTTGCAACGATTTCTACAGTACACCAGAGCGACATTTAGCGGAGAGCTACGCAAACCCCACGTCCAAGACGCTGCTCGCAGA
GAACTAGTGAGTTAACGGAAGACGCAGACGCAAGCCAATTGATCTAACTAAACCTGATAACTATTGTGTTGTTTGTTAGCCATGGAACGACGTTGGGGTA
CACAGGCCGTCGAAACTTTTGAGACGAACAGTATTTGAAGTGATAAAGACGAAACGAGTTGATTGATCCGTTAACATGGCAATTTGCTAGGTATCAAACC
TTGATCCTTGAACCACGTAT