Description :
Non Conding Region
Location :
Scaffold_1:92805- 92941
Sequence
136 bases(100 bases per row)
cagatctttttaagtgatggttaggttaggaccatcactctgcatgaagtaaggaaattactattatgaccacaagttcaatttctggaaaattgctatt
atgaccacaagttattaattctgcaagaggtggtgg