Description :
Non Conding Region
Location :
Scaffold_1:92707- 93190
Sequence
483 bases(100 bases per row)
TGAGTGCCACTTGGGTTGCAATGGCTGGTGTCCTCATCTTTACAAGATCCGAATAGATGAAAGTTTTCCGTTAATAATGATATATGACTTTCCAAAACCT
CTTCAGATTGCTCAATTTGCAGATTTGCCTGCGAACACTATCCATCGACTCGTTTCCATCTCTAATTACCAATTCTCTCTGTTCGTTCTGCTGGGAATTC
CACATGTTTTCGATCAAACATAATATTTTGTCACTTGTCTTTATATCTTCATGGATGTCGGCCGTACATGCGGCAGCTACATTCGACAGAAAACTGAAAA
GACTTTCTGGGATTGCGAGGTACGTTCTTGTGCTGCAAGATTTTTGGATGATTGATTTTGCTTCCAGCAAAGTGAAGAATCGCGATTGATGAAAGTAGAC
TTTTTCAAGCAGGTTTTCTAGACTGAGAGCAGCAAAACGGTAAATTCAAAGCAGACTGCCACTCGCTTGGATTGAGTACCTGA