Description :
Non Conding Region
Location :
scaffold_1:92634- 95252
Sequence
2618 bases(100 bases per row)
CCTGGTGATTTTGTTGTCTCTCTGTTGCCATCTTCTACGGACAGCTCGACGATGGAAGCGCAAAATTCATGGGCCAATAGTGCTGAACCGTATGGGCAAA
CTATGACTCGTGGTGGCCCCAATGTCACGTCGAACAGCTCCACAGCAGAGTCAGCTTCTGACTTGAGCGTTTCATTCCGAGTGGTGGCTTAGTGACTCGT
ACGTCAAGTGAAGCGATGAGTAGTTTGATGTGTCGCAATGGAGCCGCAAGAAACGACTTAAGTGAGACGTGGACTACGACGTGACTACCGTGGCTGGAGA
TCACGGGATTGCCACTAATAGTGCTCCTATGACGACTTTTGCTGCCTTTAGCTATCTGCGTCCATGCGATCGAGTCGAGATAAGAACACGCCGTTGGTAG
ATGTCCATCAATAGCTAAAATCTGATGCAAAGCCATTGAGCAACCGATCTCTTAGCGCTCAACGTAGCGATCTCCGCATAGAATGAGCTTCCATTTTCTG
GTTTGTCTATAATAACCAGCTACCTCTATCACATCTGCAATATCCAAGCGGCCTGCTGACCAGCACACCGACCAAGCGGCTCCGTTCAGCTAGAACTCGT
CCTCCAACAACTAACGAGGTCAGCTAGCTAAGTCACTAGCCCGGTGAGCTACTAACGACAGTGAAAAACAGAAAGAAACGCCAAGCAACGGGCGAGGAAA
GGCGCTGAAATCCCGCTGGAATACCGGAGGAAGGCACGCACATATAATAGCTCCACGTCGAGTCGGCAACGACCTTGGTGAATAAGACACCGGTCTGGAA
GCTCACTTGTCAATTAAACGAGAAGAGCGCAGGATGACACAACGGGAGTTGACTTCGCTCATGGAGGAAGCCACTGGGTACTCGGAGGCTCAGCTCATTG
TGCTTGTACTGAGCGTCGTAGTGGTGGCCGTGGCTCTACTGTCCTACTTTGTGGTGGCGCCGGAGTACGAGAAGCACCTGGACAAGCAGTATGCAGCCAT
GGTGCACGCCTCCTCGGAGCGTCACCTACAGAATCAACAGGCTCACGAGCTGTTGCTCGCTCGGATCAAGCTACGCAAGCACAAGTCGCTAGGGTCTTGG
GACATTGAGTCTGGCTCCAGTGATGATGACGGACTGGGTCACAGCACGCTGCTGCGACGACACTCGCACATGCGACCACCCGTCAGCGTCTCTTCACCAC
GGGATATGGCCACGGAGGCGGCGCGGATTGCCCGTAGAGAACGCAATGCCCGTCGACGCAAGAGCGAGAGCGACGCACACAAGCAAGCAAATCTCCAGCG
AGCAGATATACTGCGTCGACGAGTGCAGCTGCGGAAGTTGGAAGAGGAGATTGCTGGCACAGTGAAGGCGAACGAGGAAGCGCAAGCGGCTGCGACTGGC
AGTACCAACGCAACTACGAACGTGCGACGGCTCTCGGGTAACACGTTGGATCTGAGTGATGACCGACTCAAGATGTTAAAGGAGCACCCAGCCGATTGCG
TCGAGGAACTCACGGTACTTGCTCGAGCACAGTCATCGTCGCCGCTTGTGAACACTGCGGTCGTGACTAAAGGCAAGGTTGAGACTGAGCCGGATCTCCA
CGAGGTCAAGCGAGCGTTGAATGTGCTACATGACGTGCTGAGTTTCTATCTGTCAGTGGATCACCGTGACATGACCAAGCTCACGGTGTTTTGCAACTCA
CTACTGCAGCACGACGGCCTCAATCGACTTCGTGCTTTTGAGGCGTCGCGCGACCAGGACGTTCGAGCACTTTCCAACTCGATTATCGAGAAGGCTGTGC
CTGCCATTTGGCACTAAGAGCGAGTCTCACCCCAATTATCTATCAAGTAAATAGCTCGCACGCTAAAATGAATAACTACCGTCTCCTCCTTCTGTGAACA
TCATCTCTTCTGCCTCAAAATTCATTGTCTTGGCCTATTTCTTCTGGAATGACGCTGCAATCTCTTGTAGAGAGCTCGACAGCACAGTCCGGAGCACAAG
TCTCGAAATGGATCCACCACAGAGCAGTACGCTGCCTATAGTGGATGGTGTGAGCTTGGAGTTCCACACAATGAGCGTCTTGGGCTGCGACGGAGGCGCC
GTCTTGTCCGCCACGAACTGTACGAGCGCCACGTGGTCGCTCAGCAGCAGCGGGCCACTCTTCTCGATGCTGTAGCGCACAGTCGGGATCCGATCGGAGC
TGTCGGGCGGCCCTGCCGAGTGGATCTGCTCCTCGACGCCAAGCGAGACGAGACGGCGATGACCCACGAGTCCGCGACCTTTGCCGTCCTTGAGCGTCGT
ACCGCGACCGATCCATTCCATGCGAAGCCATGCGTCATATGCGTCTTCTACCGATGCATGCACGAGCTGGTTCAGCGCTAACTCTTGGCCGTCGCTCTCC
GCGTAGGCCTCGTATCCGGCAGCATCGATGTAGCGGTCCGTCATGATGATCTAGAATGGAGGGATCCCACGAGGATTGGTTGAAATGGTGTGATTATTGA
CGAATGAAATGACGCGATGAAAAGTATCTTTCCGTTACTATGCAGCATGTGTACATGTGACTCTAGTGGTGGAGGTTCGCCATGATCGCGATGTTGCCTA
TAAGGCAGGTATAAGCTC