Description :
Non Conding Region
Location :
Scaffold_1:92524- 92800
Sequence
276 bases(100 bases per row)
AACGTGCGGGAAAATTGTTTGAACTCGCACGTTTTCAAGCAGCTTTGGTAGTTAAATGACAACGAAGAGGGATTGTGACCACGTCCTTGTGTTTGCTATG
GAGCTCTTTTGCTTATTTCGCTGGTTGTGGTACACCCTGTATTCACTTTAGGTCAGTACTAAGGCTTTGTGAAGAAGCTACGGAGATAATCACGCTATTG
ATGAATGTTTTCTCGACACAAACGTGGTTTACAGCACACACACACGAAACTATTAGGCAAGCTCTTGCATGCGTTC