Description :
Non Conding Region
Location :
Scaffold_1:92464- 94515
Sequence
2051 bases(100 bases per row)
CATGTATGCATACTCAATGAGGAAGGAACTATAGTAGATTTCGTCAACTGGTAGCTCAAATATTTATTACGAGCTCGAAACTCAATGCAAATGGCAACTG
TTCGTTTTTGACTGTCATCATTTTCAAAGTGTGGTCGTCATGGGAAAACACCAACTCTAAGGAACGGTGACCGAAAACACGCCACTGAACAACTCGACCA
AGAGCTTAACAAGCCCATCATAATACGATAAATCGGAAGAGCTATTCAGGTTTCGCCCACAGTGGATATCAATTGAATGCCTTGTCATATTGGTTTCCCA
CATCCGCTGCAATATGTGGCGTCGGATAAACACATAGTGTTTCGAAGAGTGGACAACTGCTCTGATGGATGCCGCGAGCTCTCTTGAGGTCCTCCAGTGG
CTTCACGCGAATCGTAAACAAGGCTATACGGTCTACGCGATGAACAATACTGCGCACAACGGCCACTTGGACATCCTCAAGCGGCTGCATGAGCACCGTG
AGGAAGGCTGTACGAGCATGGTGATGGCGATGGCGGCTTGCAATGGACACGTGAACGTTATGCAGTGACTGTTTGAGACCTGCCCAGCAAACACAGCGGC
CATGGCTTCGCAACGCGGCCATCTTGAAGCGCTCAAGTGGCTATACGCAAACGGGCAAGGCGAGTGGACGACTGACGTGATGGACATCGTTAGCTCTCTT
GAGGTTCTCGAGTGGCTCCGTGTGAACGACCTCGGAGACTGCACGTCAAAGGCAATGGAGACCGTGGCTTCCAGGAACGACTTTGGTGCAGCGCTCTTCT
TGCGTGAGAACTGCAGAGACGCAGGCTGCTCACTGCAGGCGTTAGAATGCGCTGTGCGAAGCAGCCACGTGATGTCCCAGTGGCTGCTCGAGAACTATTT
GGATCACGTGGAGGTGCGATAACTGCGGAGGACCTGGCGCTCCCCACCACTTTTGACTGCAAGTGGTGGGGCCCTCCAGGTCGGTTCGCAGATAATTCCG
AGCCAGTCATTCCTAGCTCAGCACACAAAATATCCCGACGGCTCGCTGCGCTGCTGGGTTCGCTAGGTGCTTGCAAGCCGCGCCAATGAACCCTTTTACA
CCTCAATGACCGACTTCCACTTCAGCTACCAGAATTGGGAGGCTCTGTCGACCATTTGGATCATCACGAAGGTGAACAAGGTGAGGACAAGCTGACGGAT
GGGAGGGAAGTCGTATTTTCCCTCAATCCCGAAGTCGAGACCGTTTGCATAGGCATACGCTGAGAGCTGACGGGCGACCTCGCCATGGACTTTGGCGTGC
GTATCGTTCGGGAGCTCGGTGATGAAGAGTCTCACAGGCAGAACGAGGTGCCTTTCAGAAGCCTCTCAGCCACGCGCTTGATCATTTCACCAGTCACGCC
GCGCACAACCTCTTCTTCGATGTCCATCTCGTCGAATTCATCGTCTGCACAGGCTTCAAACGCTCGAGCTCGCACTTGAAATCGCTCTTTCGCCGCAGGT
GCTGAAATTCGAAAACGCTGGCACCACAATGAGCCAAACGTGCACTGGCTTCTTTCTCCTCTAACTGTCGGTCGTTGCCATGATGCTGCATGTGCGCGTG
CGCATGCAAGAAGGCGAGGAGAGGACGCCGTTTGGTGGTCCTTTTCCCAGGCAAAGAAAGGTGGGCTATGATATGAAAGTTGGAGAGGATTTCGAACCGA
ACGAAAGTGAGTTGCCGATACGCTGATGAAAGATGCGTCGTTGGGAGACAACAGCTCTCCAACGCTGACATCTCGCACATCGTACGTTCGAAGTAGGACA
CGAAGCCAGTGTTCATTCCAAGCTCGGTCAGTTTGCTCTTATTAGCTAGCGGACGCCGATGCAAGTGAGTCCGACTTCCGACCATGTGCTGCTGCTGCAC
GTGAACGCATTCCAGACCAACAATCCATCAACTGCGAACTCTAACGGACTCACATGGGGAAAACGAATACATTTATTATCCAAAGGGTTATGAGCTGCCG
ACCATTCTCTCTCTCTCTCTCTTGTCCTGCTTACTGCCATTTCCCTTCTCT