Description :
Non Conding Region
Location :
scaffold_1:92452- 94020
Sequence
1568 bases(100 bases per row)
GCTATATCGGCGGCTGGTGCTGGAGCTGCGGGATTTTTGACACTGTCAAAAATAGTCACACAAGTGAAATGGGACATTTTAATGACTTACTAACAATACC
TGTTACTGTTTGATAGGAAACTTATGTTGCGTTAGATTTATTGAAGCTGCTATGTTGCGGCAAAGGGAAACTCACTCCAAAGAAAGGAAGCTGGGCCATC
CCTCGATCCGTGGCATCATAGCAGAGTCAACGTCCACCTTGGAAGACTGTTTATTCACGTTGGACTGAGTCTTGCGGACCACGCACGAGAGCCTGCTGGC
TGGCGAAAGGCGTGCGCTTGGGCGCGGAGTTGTTGCAAGCATCACCGAGAGCGTAGATATTCGAGTACTCTGTACTCTCCAGCTGCAGCTTGCTGTTAGC
CTTGATGAGACCTTGGGGCGCCACGAGGGAGTGGTCAAGGCTCTTGATGAGCTCAGTCTTGGGGTTGAAGCCATCGTTGAATATCCGACCAGCTCCCTGC
CAGTGTTGGTGCGCAGCATGCGACGCTCAAAGTTGTTGTCCGACAGCCTGTCCGTCAGAAGCTCGTCCAGGGTCGCATTCACGTCCTTGCGCTTCAATAA
CGGGTGTGGGACTTCTCACACATGTTGTCGGTACTGAAAAACGTGTCCTTGCCTTCGACGATCATTACAACCTTGTTCGGGAACTTGACTTGATCTCGCC
AGCCACTCCAGCGCCGGTAGCGCCACCGCCATCAATGAGGATACTGCCAGCACTCTCGATCTACTGACGTAGCTCCGCCTTCAGTTTCTCAGTCGTCGAA
CGCCTGAAGTTGTTATTCGGCTGCTTCATCGGAGCCTACCAGGGAGTCGTAGTCCATGTGCTTGACAGGTGTCGTCGTCGTCACCGATCTCCACTCGTTT
CTGGGCACAAAAGCATGATTCTTAGACAGTGTATGAACGTGTAAACCCCCACGACGGGTCTTCGAGTTGGAGCACGTTGTCGTCTGGCAGCAATGACAAC
TACTTGTGTATCGTCGCGGTTGACTTGGACACCTCGAAACTCAAGAGATGGAGAACTCTTCGCCATGTCATCCACTGAAAACACACACCGCTCACTCTGC
AACCGAACGAACGCAGACACCCTCAGCCCACGGCCGGCGAATTCTCGCGTACATATATTTCCATCGGAAGCCCCGCTGTCTGCCATCCTACGCTCGTTAC
TACTGCCTACATCCAAAGAATAGGAAGAGATGGCACTTCGTCCGTGCGGCTCCATTTGCTGTTGTTGGCTCTGATGAACCTTACTGCTCTAGAGGAGACT
GACATGAGCCGGAGCAACTGGACTGCAACGTGCGGCCCGATAGTGTACACATTCGCGGGTTGGGCCCTTGTTCTTGAATTCTTCAGGCCGCTCGTGAGCT
TCCTCACTATTTTTTTTATCGGGCTCTGGTGCCGCTTGTACGTGGACTTCTCCGCCGTGCGTGGTCCATTCGACTAAGTCGAGGCTGGAGGGTTGTGTCA
TTTTGCTGAGTGTTGTCTTGGTCGCTTACTTGATGTGCGTCTGTTGGTAGTTGTACGTTCTATCCGTC