Description :
Non Conding Region
Location :
Scaffold_1:9210- 9916
Sequence
706 bases(100 bases per row)
GTTCAAGCGGGAGCTTCTTGCTTGCGCTTGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGCCGCCCGTGCGCCCAAGACAGCAA
GCCACGTGGAGGCAGGCACCCCCAGCAAAGGAAAAACCTCAATCCTCTCTCAAGTGGAAACTGTTCACAGAGAGAACGGGAGACAGAGTTGCCGGATGAG
GGGAGGAGTTGACATTTTTGGCTTTGCTCCAGCAGTTGAACCGGATGGGACAAGGAGAGAGGATTAGCTCATGTGGTGAAGTATGCACATGTACTCATAG
TATGTATGGACGTGCTGGCGTGGCACTCTATCTGGGAGTATATCGAGTGCTGTATACACATTGCGGTGACGTTTTTGGGAACAGCACGTGATCCGTGACG
AAAACAGCATGCGGCAATCGGCGGGTACGAATCAACCGGGTGCAGTTCACTCTGTATACTTGCTGCTGGTATAACTTTTAGGAGCATTCTCCGCTCGATA
AACCTCTGTTAATACCTTCTTAAAATGCATTCAATGGTGTGGTAGACATTAATACTCATTATATCAGGTAGAGATAGCGAACTTTAAAAGATGCAACACA
GTACACTATTTAGAAATACCATTTAGAAACATCGTTACTTTGCTTTACTTTTGCCCTTCCACCAACAGCTACAAGCAAGCAATATTAGAGCAATATTGGA
GTAGCA