Description :
Non Conding Region
Location :
contig_1:92049- 92300
Sequence
251 bases(100 bases per row)
GCTATATCGGCGGCTGGTGCTGGAGCTGCGGGATTTTTGACACTGTCAAAAATAGTCACACAAGTGAAATGGGACATTTTAATGACTTACTAACAATACC
TGTTACTGTTTGATAGGAAACTTATGTTGCGTTAGATTTATTGAAGCTGCTATGTTGCGGCAAAGGGAAACTCACTCCAAAGAAAGGAAGCTGGGCCATC
CCTCGATCCGTGGCATCATAGCAGAGTCAACGTCCACCTTGGAAGACTGTT