Description :
Non Conding Region
Location :
scaffold_1:91967- 92101
Sequence
134 bases(100 bases per row)
CAGACTGTCAATTAGGATCAACACACAGAGGAACCCGATTTTGAGGCAGAAACTAGCAACAGCAATAAAAAGTCACGTCGTCTTCAAGTGTAAAGGGCTC
TGCATTGCTCTGTGTAAACAGAGACTGGCGGCTC