Description :
Non Conding Region
Location :
Scaffold_1:91858- 92329
Sequence
471 bases(100 bases per row)
CGTAGTATATAGGAAGATCGATATACTTATCTGGGATTCCAACTTTATACCATATGTTATTTTTCGAAACAGAACCAGCAGTTCCTGCGAGGTATCGTGA
AGAGTTGTTCCTGCAGTCACTACTAGTGCAGTCACTACTAGTAGACTCCTTACAGCTATAGTAATTACGTTCTTGGTTGTGCATGATGTAACACAGGCCC
ATGAATGCCCAGGCCGCATACCCACGGGTCGTGCCCATTTGCTTGGAATGGATCCAGGCAAGCGTCACTTTATCCGGCATTCCGGATAACATTCCCCAAA
TCATCGCGTGATCTGCGCGGCGACAAGGACATGATCCAAGCCGCCAAAGTGCTCAGTGTCAACCAAGATATGACGGACGCGACTGCTTAATAAAACCAAG
TATGGCATTCAAGTTGGGTTAGGTTGGCATTGACGTCACTTCATACTGCAAGGATCGATTGCTCTTGTACA