Description :
Non Conding Region
Location :
Scaffold_1:91696- 91968
Sequence
272 bases(100 bases per row)
GGAGTCTCTTGGGTCACTGGATGCACACCGATCCAGATGTGGTCGCACACGAGACCGAGATCATCACTAGACAGTGTACTAAGAGCAGCCCGGCACGCTC
TTGTTGGCAAGCGAGTCCATGCAATCGTGTACTACTAGTTATGTAGTCGTTTAGTAGGTGGTAGTCGCATGTTCGCGTTGGACTGCGCAGTTTACTTCGA
CTAAACGACTGTACGATTAGACACACACGAATTTACACCTACATACTATTTGGCGTTTCTACTTTTGGTATC