Description :
Non Conding Region
Location :
contig_1:91563- 91698
Sequence
135 bases(100 bases per row)
CAGACTGTCAATTAGGATCAACACACAGAGGAACCCGATTTTGAGGCAGAAACTAGCAACAGCAATAAAAAAGTCACGTCGTCTTCAAGTGTAAAGGGCT
CTGCATTGCTCTGTGTAAACAGAGACTGGCGGCTC