Description :
Non Conding Region
Location :
Scaffold_1:91463- 94194
Sequence
2731 bases(100 bases per row)
ACTCCTGAGGAAGATGGATGATGGATCCTGAGTCATTATGGAAGCAGCCGAGTCCGCTTGCTTATCCCTGTTATTTATGAAATTTTAACGAGAGAGAAAC
GACGATGAAGGAAGAAAAAAGAAAAGAGGAGTTGTCAAGTACAGTAAGTAATGAAGCAATATAGCAATAAAGGAAGCTGCAAGTGGGCTTCGACGACATG
AGAGTAGCTCATGCACTCAATCGAATATAGAGTAGTAAGTTTTCTCTTTTAGAAGTAAGGGCAAGTTAGAGTCGATCAGATAGAGTTAAAGTAGTACAGA
TACAGCAACAATCACACTGCATTCATAAAGTAGCAAGTAAATACAAAAATAATAATTGGGAGAATAAAAGACTTGGCTCGTGTTGCGCCATAGTCCCTAG
GTTAGGGACAGTTGCCTTTTTTTGGTTTGGGACAAGGTCATAACTTGGTATCTCCAAATAAATCCGCTCTCGAAGGCGAGGAATCGTTTCTGTGGTTCAA
ACCGAGCCTAGCGAGCATGGAGCCGCAGTTGCAACCGACACTGCGGAACTCTGTCTGGTTTGCCGGCACGTTATCGTCATCATTAAGAACATCATCTAGA
GAACCAACCACGACGGAGTGGGATTATGGACCGAGGCGCCACATACGTCTACGTCCACACGAGCTTGCTCATATGGAAGGCCGAGCGCTTTGCTCCGTTC
CTCACGCGGAAGTTTAAAAGAGGATTGAAACGGATGCAGAGACTGTATCCAAGAATGAAGAATATGTGTCTGTCAAAGTGAAAAAGGAAGCCATGACTGC
TAACGGATCCTCATCCACCTTTTCCTGAGATTGCGACTGAGCAACTGAGTGATGCGAATGATACGCTCGATCGTGTATTGCAATACCAACTCACGCCGGA
TGTATGGTGGCGCAGCTCAGTGGACCACGAGTTTGCCATGTTTAAGATTCCAGCCCGTCACAAGATGATCTGCCGCTTGTGAATTGAAGATGAATTGATG
GCTGGTTTTTATCCGTTGCTGCGGACGCGTCATTGTCTTGGTGACTGAATGCAGATGCTCCATCCGTTTGAATTCGCCCTTGAACTTTCGAGCGAGAAAC
GGAACAAAGCGCTCGTCGTTCCACATGTGCAAGCTCGTGAGAACGTAGACGTGCGTGGCGCTTCGATCGACAATTAGCTCCGTCGTGATTATGCGCTCCG
CTCCCGTCGGTGAAGACGACGTGATGGCGACTCGGACAACAGAGTTGCGCAACTTTGACTGAAGCTGAGGATCAATGGGCAATAAGCTCGATTTGGACCA
CAAAAATTTCCGTTTTCCTCATCGCCTTCGCAGAAGGCATGCCCACCAGTACGTGAAGTTCTTTCGTGTCGTTCAGCACCAGGTAACCGACAGATATCGC
CAGATCAGAAGCTAAATGCTCAATGCACGCTCGTGCCAACTCGATGAACATTAAAAAGTGTAAACGGGTCCATGCTCTACGACCTCAGCAATGATATCGA
TCCAATACTGGTACTTGTTGGGGACTGTTTCCTTTTTCTCTAGTCCGAATCTGTATTTATGATGAATGTGCAAATCGGTCACGTGGAGGTTCTTTTGCTC
ATGTGAGAGCAGCAAGGAAAGGAAGGAAGGAAGGAAGGGAGCGCAGATGGTTACAATGATGTTTGTGTTGTTGGCGTGATGCGGACGAACCCTTACCTGG
AGATCAACAAGAGTGCCAGGATAAGTGCGATTGCCACACGAATACCGTAGGCGTCAATAGCGTAATGTAGTTTTCCTAAATGCACGTGAACAAGGCATAC
AACTGAACGATCGCAACTGAAGAGACTTTTGTGGCAACGATACGAAACCAAGTTGGCGTTGGCGACAAATACAGCAGCACATCAACATCAACTTCAATGT
TGCTGTTCCGAATGTCCCTTAGAACAAGTGGGTTAAATTCGGGACGTTTCCTTTCGCGAAAAGGTTTTCCTGTCATTGCAACCAGCAACACAAGACCAGA
GGTTGGCAATTAACGGTCAACAAGAAGAGCTCAGCGCATGCTCAGCGGTAGTTGTCTCTTCGCCTCACTTGACTGGATAGAGCGTGAGTTCCGCCGACTC
GAATACTGAATTCGATCTGTAGTTTGTATTCTTGAGCGCACCTTTAAGGTTTCGTAACTTAAGAACCGCGGGCGAGATCAGTGTGATGTGGCAGAGTGAG
GCTCTAAGTGGAGCTTCCGAAAGGTATCAAATTACGAACGACAGTGAAGAACCAGGACTGTGCGACGAGAGAGCTCAAGCAACCAAGACAGCAGAAGGGT
GGCGATTGATGAAGCTCGCGTGACGAGCCGATCGAGCCATGCAGTCGAGACAGTATGCGGAAGAAAGACTTTGAGCGGGCCAAGTAGCTGTGTTTTTTGT
TGTTGTGACGCGCATACTTGACTCGAATGTGTGGTAGGGTCGCATCATTAGAGATGATCATCATCAAGCTCAGTCTACACAGCAGCCCTTGCAGTGACAG
CGAGGCTTCAAGATAGCTGTTGAGGGTCGGTCGAGACTTTCCCAAATCAGTCGTTCGAGTGCATCAAGGTTGGAGTGCATACTACTGAGGTCGAGAAATG
TTGATCAGTTCTTACAAGTCGTCAATTTACGTTATTACTACGAGCGCTGGCATACCTTTGCTATTTTACTCGCAATTAGATTCAATATGAACGAGATGCG
CGCCTTGCCAGCACATATGCTTTATATCACT