Description :
Non Conding Region
Location :
Scaffold_1:9118- 9581
Sequence
463 bases(100 bases per row)
GACGGCGGCAATAGCTTCGGGACTGGagagaggaagaggccgGCCGATGCAGTAATGAACACCTAATCGAGACGCTCGCAACGGCGCTTCCGGGCAGCTT
TTTGCATTGATGTTTGTACCGTACACGCAGCCTGCGGCTATTAGCTAGACTAGAGAGTGGCGCGATGCAGGACGACGCAGGCAGCATGGGCGGGCAGAAT
TCCAGCGATCCACTCGCAGTGGCAATAAAGCCAGGTGTTTGGCAAATAAGTCCTTATTTTAAGGACCTTTGAGACATTTGTCCCCATTCTCCCCAAATGC
GTCAAAAAGTGCCAATGTTCCCAATTAAATGGATACTTTCGCGGAATCCCGTTCGCTTAACGAGCCAAAAGTCCATTGATTCCGCGAAAGTATCCATTTT
AATTGAGCAATGACCCATTTAAAGGCCCCAAAAAATGGCTACTGGTATATatataaaaaaaaa