Description :
Non Conding Region
Location :
contig_1:91057- 93085
Sequence
2028 bases(100 bases per row)
GCGAGCAAATGGGTCTTGGGGAGCACTGCAAGTTTGGAAGTTTGGAAGTTTGGAAATGGCTACGTCGGGACTGGTTGATGCGCACTTTGGCCAGTCAAAG
TTAAAGAAATGCGGAAAGAAAATGTAAGGAGCGACCTTTAGTTAATGTATCGTGCCCTCAGCCAATGAGAGCGCTGCAACATAATAGTGTGTGGCTACCA
GCCCGCACTAAATACGGTCAAGTTGAAGCAGTCGCGCTTCTCCACTGTAGGCACCGCCGATTTCGGCTAGATCCTGCTGTGTTCCCTGAAATACTCTTTA
TGGGAATTGCCAGTCTCTACCGACTTGGCAACACTGACATGAAGCTGGTGTTGGGTATTCTGCTATTTTGCGGTGGCTTCAACCCTACGACGTAGCCGAT
CAAAAACCTTGCACGCCAAGTTTCATGAAGGTCAACAGCGAGCTGCAGTTGGAGAGTGCACAGTACTCGAACACCTACGCCCTCAGCGGTGCTTGCAGCA
ACCCCGCGCCGAAGCACATGCCTTTCGCCAGCCAGCAGGCTCTCGCGCGTGGTCCGCAAGACTCAGTCCAACGTATGAGGACTAGATCCTCTCTTCAGTC
CACATTACCATGGCATCTTCGTGAAAAAAAAACTCCAACGCAGGTACCAGCCACAGGTTGAGGTCAACTAGTGGTCTCCAGACCAGTAACGCTGGACTTA
CAAATAAGATCGGGTCGCGGTGGCCGCATTGCTTGTCACGCCAATGCCGCCCTCCTTCGCATCGGTTCATTCCTCATTTTTCTTCGGGCCCCAGCAAACT
TTACCACAGTAAGCCCACTTCTACTCCCCACCGGCATGGCGCCGTCTAAGATTGCGACCATGTGCAGAGCGCTCTGCGCCGTCACCCCTACCTATCTACT
AGCGAGGTCGCGTGCTTCACAGTAAGATTCACCCTTTCTCGACCTGAATTCTGTAACTTGTCTTACTCAATCGTTCGTGGACAGATTCCCCACTTCCGCC
ACCTCCGAGCTTGATGAAGAAGATTCCGCAGACGACGATGAGTGGGGCATCTTGCACGCCCCGACCCAGACGTGCCGTGTGAAATTCGTCACCGAGTCTC
ACGGTCTTCAAGTATCGCTTGTTCTGGCAGTCACATCTTGCTACCATGCACCCCGACTGCAACACACTCAGGCGGTGTGGACGTTTTCCTCTGTGGATAA
CCACTCAACTCGCCATGTTCGTTTTGTCCAAGCACCGATGTCGCTGTTAGCGAATTGGTGTCGTCCCATTTCGGCGCATACGTGAGTGATCGATTGGAGT
TTGCTGCTCACAGACACCATCAGTGGGCAGAGGGTAATCAGCTGTGCTGGTCCCCACGCCTTACGACCCTTACACCCACGGCAACAGGCATAGTTGTGAC
AACGTCCCAAGTACTGCATAGTGCCAGCACGAGCAACCAAGGTGCCGAAGCGTATCAAGTGAGTATTTCGTACCAGAACGCCAAAGTGGAAACCCAGCAA
CTAACAGAAGACCACCACCACGCTGACGTGGAGAAGTCGGCAAGGAAGATATCGAGCTTGCCTCGTATGCAACCGCTCAACGTCAATCCTCGCTATATGG
ACTATGAATGTTCAGCATCCTATTGCAGGAGACGCCGAACAAACGCAGAGCGTCGGTGTGCCTTCGAGTCTTCTTCTCCCGCTTGCAAGAAAGGCAGTGG
CCTGATATCGACTGCTAGTCCCATCGGCAGCTGGGAGCAGATGCGATCCCGTATCAAGCTGGCGAGCTCGCGTTTATTCGCGTTCGAAATGGACCCAGCC
TGGCAAGACCGATGCAAGCACAGCAAAGCTCGTCGTGCCAAGTTACAGTCAGCATCGTAACGTCACTACCAGACCAAACCTCCACTGAGACGCTTGAGTT
ATCGGTGAGAGCTATGCAAGCGTATTTATTTGTCGAGCTAGTGTCAGAAGAACCATAGCTTTTATCAAGTGATCAGAACGAAGCAACTGTTTTCCCAGTC
AAGCTGAATGACCAAAAACTTTGTCGAT