Description :
Non Conding Region
Location :
Scaffold_1:91050- 92188
Sequence
1138 bases(100 bases per row)
GGAGCGGTATAATTGCAAGCCCGAAGGGTGAAGCTATTAGTGATTGTGCGCAAGGTTAAATGCCGAACTTTTAAATCGTACTTATCTCTGTGTCTGTGTG
TGTCTATGTGTGTCTGTGTGTCTGTAAATAACGCAGTTAGGTGTAATCCCACGTACTAAGTACGATCTAGCATCTCCCCCCTCATAGGTATATAGGCATA
TTCAAGTCACTCTTTGGCTAGGTCAATATTGTGACGCACGCACGTGATTGGCTTAAAATCGATCAAAGGTGAATATGACCACATAAGCAAATGCTGGACG
CTTCTAAGCAAAGGCCGATCACGTCGACTAAGTATGCTGTACTAGATTAATACAGACAGTAACAGGATCATACTCCTTCTTCAGTGACTGCTGCTTTTGT
ATAGTGTTTTGCAACTTGATCCAGTTCTCCGAACTGGATTACTTATATCAAAGGGCAGCTCCAGAGCGCGCTCCCCTATCTTAGAGCGACAGCATTGAGC
GAGCGAGCGAACAGAATACAGATCCAGTAACGACTTTTGTATAAATTTAGAGATGTCTGCGTGAACATAGTGTGTCTGCCACGTATATTATCGGCATTGA
ACCACGTCATGTCCTAAAATGTGTAAGATCGGTGCCTCGCCGTCAATTCCTCTACCAGCTTATAATCGGACGACGTTGCATGCGCTGTTGCACGTATCGT
GTTAGACGGGTTTAAACTTAATATACGTTTCTAGAGGTCAGCACCCTTGAGCGATTGGCCGCCAATCAATTGAGGTCCAGCCACACTTTTCGTGCCGTGA
CGCCGCCCATACCTTCAGTCCCTCGATCGTCCAATTCATCCGACTGGTACGTGTAAAAACCTTAGGTCGATCCTGTTGGCACGATTGCATCAAGACCTTC
TCTAGCCTCTATCCCGCTTAGTCCAGTCAATGACTATAGCAATACAAAAGCTCTAAACCCAGTGCAGCACTGCTTCTTACACCGCAAAGAGCGTGTTTCA
ACACTTGTTTCGGGCATCAATATAGGAGAGACAGAGAGAGGCTTGAGCAATCGCTAGTGACTGGAGTTGTATTGCAATGGCTTCTGTACTCACATGGCCT
TCTGAATACTCTTGTGTGTGGTCAGAACTTTGCTAAAA