Description :
Non Conding Region
Location :
Scaffold_1:90973- 91097
Sequence
124 bases(100 bases per row)
TCGAGCTATGTATTGAGCATGATGCCAAGTTGCTCTAGCCACGGGCGCGAGACTACACCAGAGCTGAGTTCTCCTTAACCAAACGCAGCATGTGTATACG
ATAGACCTGCCATTATGACCATTC