Description :
Non Conding Region
Location :
Scaffold_1:90948- 91200
Sequence
252 bases(100 bases per row)
GTGCAAGGACGCTCGGCTCAACTGCCGACCACACCGTGCGCTCGTCATGTCCAGTACAAGGAGGAGAAAGCAGGTGGGCACCGCCATCGAGGGCATGCGA
TGATATTTTGTTTCTAATTTAGACTTGATACAGGTATGGAGCCGATCCGAGTCGAGTGACGCGAAGTACGTTGTAAGAAAATGAATGAACCTAAAGATTA
CATGAGATTAGCACACCAGAACTGCTCGTTCCCAGACACaaacctgcagctt