Description :
Non Conding Region
Location :
Scaffold_1:90925- 92894
Sequence
1969 bases(100 bases per row)
GCGCCATCATCCGTGCCTCGTACGTGATGGTGGCCGATGACGACGTGTACACACGGCTGGACCGGCTTGTCACCATGCTCAAGGAGGACACAACGCCGCG
CACGCGGTACTATGCAGGTCAAGTGTCTTCCGTCAAGCTTCGACGCTTGGTGCCGACGATCCGAGAGCCATGGCATAAGAACCATCTATAGAAGGACGAG
TACCCCCTGGCTGAGCACGCGCCTCGTGCTGCTGACGCCCACTATCTACTCTCGGCCAACCTCGTGTAGTTCCTCTCGCGGAATCGCCACGTGCTTCGCG
GAGTCGGTGCTATCGAGGCTTGAGCGTCGCCTTCTGGCTGCGTTCGCTTCTGCGAGTCCATCGCGTTCATCTGAGAAACTTTGAGACAACGTTGTGTGGG
ATCTGTCGCGCGTCGCTCTTCTCGTACGGAGACCATTCTCCCCTTGCAATGCGGCAGATTAAAAAGAACATGGAGGTCGGGGACGCGTTCTGTCATGGGT
ATTCATGGGCTGATGGTCGCATCCCAACGCCAAAGATCCCAAGCATGCCAAGCTGTGACCCCGGAGCGACACGGAGTACAAGTGGGACTTCCGCGTCGAG
CCGTCCACGCGCACATTTCGAATCGATATCACCTCTCCCCATCAGTCGTTCTGCCCGAGGTCTCCCTCACGCCGACTCTAGAGCACTACCACGACTTTTG
CCTTAAGCTCCAAGCGGAGATCACACGCTTCGCTCAGCGTTTTCCGCTCACGTTGTGCGAGGACCTCTTCGACCGACTGGAAGACTATCTCGAGACATAT
CCGCCAATGAGCGCAGCACTACTCGTGTTGACGCGCTCCAACCTTCCACCCACTGCAGGCCATTTTGNNNNNNNNNNATCTCGTACGGAGACCTTTCTCC
CCTTGCAATGCGGCAGCTTAAAAGGAACATGGAGGTCGGGGACGCGNNNNNNNNNNATGTATGGGTGTCGCCGCGTATTATTCTCTGGCGCGTGTTCATC
AAGTGTCTCTTTGCCGAAATCTATCCGGATATCCACGTCTACGTCGTGGACGAAACGACGGAACCCGATCCAAGCATCGTCGTTGAGCCCGATTTTGCAG
TTGTCAGTGGGGGCGAGCTTGGTAGTCTAGCAGTGTTTCCACCGAGCTGCCGATTCCTCATTATTGAGACGGCGCAGTCTCCCTGTGGGCAGCTTAAGCA
ACTACAAGAACGTGACGGAGTGATAATAATCACACATCGTCCACCTGCAGGCAACGTCCAGATTGACCAACCAATTTTGAAGATGCTGGCCATTCCGCTG
GCGTCCCTGGCGTTCAGCGGCAGCCTTATGTTCAGCCCACTCGCGCTCCTCCAAGCCAGCAGCAACCGCCGAGCCAGCTTCTCGCCAGTCGAGCCGTTCG
TTGTGCGACACTGTAATACGCAATCCGCTGCGTTCATCGCACTTTTGCGTGATGGCTCAGGCTGCATGTTGGGTTCTTCTGCGGACGCAAATCGAGTCAC
TGATTCTCGTATCTCTGATGGGACATTGTCTCGCGACACCATCTTCGTGTTGGATGCCTTGGTCTCCAACTACTCCCGCTTCAAGTTTGTGCTGGCCATT
GAGCCCGCCCAGACCCGCGCAGTTGTCGCCGAGACGATCGTTGCCGCATCCCTGGCGGGAAGCGTGCCTGTATACTGTGGCGATGATGAGACCGCGTCAA
GTCCCTTTAACCCCACGGCCTTGATCAGCTGCATCCGCTTCGCATCTCTCAAGGCACTATGTGATGGCAGTGCACCACTCACGATCGCTCTACGAGAAGA
TGAGAAGCGAACCACCCGTGGCGAACGAGACAGCGCTTTACGAGTTCTTCTCGTGGCATCAAGACGTTCTTCGCCCACTGCAAGAACGAGAAGATGAAGA
GACGGTCTCGCATCTCAGCGTGGTGGCGCGTATGCAAGATCTCATCAACAGTATCTAAGTCACCGTGTT