Description :
Non Conding Region
Location :
scaffold_1:90803- 91137
Sequence
334 bases(100 bases per row)
TAAACACTGAATAATGCTGCATGCCGCATTCCCGTTTGTATTCATTAGCCTTAGCTGCAATGGCGGCACTTTCGGCTAGCAATTATAATGCCGAGGAGCG
CCCTCTTTCTCGCTCCTTCTTGCGTTTGCTATGGCCAAGTTTAGCCATACTCTCCTGCAGCTTTCTCCAGAACGAGCCCTTCTCACTTGGTGTACGCTGA
GGACTGTCAGTACCGATACCGAATTGTTGCCGCCTTGCAATACCAGGTGAGGCTGTCCAGCTCTGGGGAGAGTAGCAGTAATCTTCCAGCAGTTTGTCGC
TGTATAAGCAACGTTTCTGCATTGTGCAATACGT