Description :
Non Conding Region
Location :
Scaffold_1:90488- 91137
Sequence
649 bases(100 bases per row)
CTGCTGATGGTGATGGCGATTCGATCTTTATTTTTGGTTATGTGACTGTTGTGTGATGCTAAGAAGGTCTTCGATAAAGTACGATATATATTAAGTACGA
TACCGTAATTAGCATTCCAGAACAGGTAAACCTGTTTTTAATAACGATACCATTTAGGTATCGGGTGCCCGTTATTCGATTTAAAAAGGTATCGGGTGCT
CGTGTCCATTCATGATGGACACTCGACATGGCTCATGATGGACACTCTACAGAGAGAGAGGAAGGTATTCTATTTAGCTGTTACGCTTAAGAATCCTGAA
ACTGCCCAAGTGCTTTTGTGAGCGAGGTGTGTCTCAACATTGTCGGTACCCCCGAGCCCGAGGAGATCGTTGTCCAGTTTGTCTTGCACCATATTGTATC
TCGTTCGAACTTGTCCGTGTCTATCCGCTCTGATGATGCTGTTGGTATGGGAGTCCATCACCATGTTCGCTAGGTAGTCCGCTGCTGTGTTGTGCTCGCG
CTTGAGATGGGCCCAGGAGATCCAGAAGAGGAAGCTGGCGCTGTCTTTGATGTTCGCTGCCATAGGTATGATGGACACTCTACAGGAAATAATTCATCTC
TATTGACATCCACTCGTCCCTATTTACAATGCGTGCCATCTATTCGACT