Description :
Non Conding Region
Location :
Scaffold_1:90397- 90857
Sequence
460 bases(100 bases per row)
ATTCCTGGCTTGGCTTAAAAGGCTAAATGACCGACGCAAAGGCTGCGCGCACCTCCATTCCCAATAACGCACAAGCAACTACCCCTCACAGCCAGCCAGC
CATTCATTTTTCAGTTTTTGTACCGGTAAGGAACGAGGAGCAGGAGTGAGATACCGGTATTCAAAAGCGGTGTTGTGTACTTTCGTGCAACCTGTGCATC
CGTACTTAGGCAATCATGCTGGACGGTATCCCGATGTTGCTACCGGTTTCTTACTCGTCTTCGTGCAACCTCACCAATCCGTACTTTGCGTGACAACTGA
TAGTCACATCTAACTTGAAGTACCCCTTTTAAGTACGAATGTCGGCTGTCTTCTTATCATTCGTCCACGATGAGGTGCTTCTAATCAGTCAGTATGTGTC
TGTGGAGCTCTTCAGTTCCAGATCGGCATTAAGAGAGAACAAGAGAGAGAGTGTGCGCGA