Description :
Non Conding Region
Location :
Scaffold_1:90243- 91771
Sequence
1528 bases(100 bases per row)
TCGGACTTGCTTCGAAATTGGAAATGGCTGTTTTTGCCGCCCGTATCCGGATGCTGAACATTGCGATAAAATAGTCTATCTTAGAAATAGTGCTGCTTTG
GCAAAGCCGCCGAGTAAGGAGCGAGGAGCCAAATATGCAGTGAACAAAACAACGATAACTCCATTTCTCATATGTACCAAAGATAGCACGTACTGAAGAC
GCTGCTGCGCAGACAAGTTATCACCGTCACGAGGAGCAAACCAATTGGTGTGAGGTCTGTCAATGAACTGATATAGTGTGATGCTTATTCGGCATATTTT
TGGCTTCGAACTTCGACAAAATTCGAGATCTAATCGTAGATCGCATTGGTCTTGGGTTTGGAAAGATATGACGCGCCGTATTAGAAGGATATTTTGTAGT
AGTCCATGACTATAGTGTACACGGGATCGGGAACATGTATAATAGACCACTGATCTATCTAGAACCCGACGGCTTTGGAGCCGACAACGCCTTCAAAGAA
AATGTGTGCGTTTTAAGCCGATTGGCGACAAGACAACCTCCAAAGCGATCTTCGGGAAGAAAACAAAACCAAGCTTATACTCGCGCCTGAAAGTTGACTA
GATAACTGAGGAAGCCACATCCGAGCTCTTTTGTCGAGCCTGCACTTTGTGGCTTTTGAGAGTTGATTGCCCGGCGTCGTAACGCGCAGAAATCCAACGA
GTTATCAATCAGCCACTACATACAGCGATGGCCACTTGGCGCGGACATGATCAAATACCTGAATGTACGTCATCTCGGTGTGCTGGACGTTGAAGGGAAC
GGATCACCATGTGTGCAACGACAACGTCCCACGAAAACCTCCAAGCGCGACCAGCGAAATCGGCTCGACGGAAGAATGGCTCTAGAAGTCTCCCAAGCCT
GTGGTGGCTTCCGCGGGCTACGGACTGTGGACGCTGACGGAGGCCAGACGCAATGACACTCTACATCGTCTCGCCTGTCGCGCGCGAACCATATGCATAC
AACGGCGCAGAACTCAGCGTAATTCCTCGACTACACGTTGAGCCCGGCCGCGTTGCCAGGTTTGTTTGGTAACTCTTGCGAGAGCAGAGAGCGTTTTGGT
GCAGTGAATTCGGTGCGCCGGTGTGGCCGTGCCCACGTTGCTTGCATACACGTGGGCGTTCGCAACAGCTGTCTTACCGCTCACGCCCGGCGGAAGTTCG
TTCCGCGGACATTGCACATGTGAAATACCAGAAAACCGGCATCTGGACATGACACCCAGTCGAAATTCAAAACTTTTTGCTCCAGCCCATGCTGCCACGT
CCACCTCCACCTATGTACACTCTGCTGGTGAACGAAGCGACGCGTACGTGGGTGTCTCCTTGACGACGCCAGACTGTAGGCGTACGACTCGTGTCAGATA
CAAAATTGAAACAAGAAATTGAAAACTACAAGAGTTCGTGCCAACCGCGCATCGGAACATCACCGACGTCCGGTCCAATCCACGAACCTGGTTTGAAATA
CGACGGATGTGCTATAATTATAGCTACT