Description :
Non Conding Region
Location :
contig_1:90054- 90163
Sequence
109 bases(100 bases per row)
GAAGCTCGACCCACCGTACAAGACGTCAGATCCAATGTCAAATGCAAAAACTAACTGTATTATTCCTACACGCCAGCAAGACGCGATCCGCTGCCTTCCA
GCAAGAGAT