Description :
Non Conding Region
Location :
contig_1:90010- 90119
Sequence
109 bases(100 bases per row)
GAAGCTCGACCCACCGTACAAGACGTCAGATCCAATGTCAAATGCAAAAACTAACTGTATTATTCCTACACGCCAGCAAGACGCGATCCGCTGCCTTCCA
GCAAGAGAT