Description :
Non Conding Region
Location :
scaffold_1:89746- 89962
Sequence
216 bases(100 bases per row)
GCTCGTAGAGGGGGGAAGCGCGCCGAAGCACCGCAACAACTCGTAGCAACACCTTCAGGCTGTTGGCCAAAACAATGTGTACACAAATGTTACCTCAAAA
TACGAATTGTTTGAAATATTTACTTTGAATTATATTATATTTTAACTTTTCTTGCAAGCTTCCAAAAAAGTAAATAGCCAAGATACATGTATTCAACTTC
AAGGTTTGATTTGCGA