Description :
Non Conding Region
Location :
Scaffold_1:89743- 90169
Sequence
426 bases(100 bases per row)
CGTGTTTGGTTACCAACGAAGGCTACTGTAGAAATGCTGATATAATATGTAAAACGCTAAATTGACTGTGGAACGATGCACACAAACCCTAATTGTAGCA
TTCAAGTACTAATAGTTATTATAGTACTAATAGTTTGTGCGAATAATCCTATATGTACTTTTACAACTGAATACCGATGCATTATTAGTCTATAACTTAC
TATTCGTATAGTATTACTACGTAGTACAATACTCTTAAGTTGCAAGGGGAGGCACCATTTGACTTGGGGTGTCGCAGCAGGTCCTCGTACTATTCCGACA
AGGCGGCGTCGACTTGGTCGCACACAGCACATGATGCTCTCCTCTCGGGACTATGTGAAGAAAATGAGGCCGCTGACTTCCCAAAGCCAACTTTCGTCAA
CTCGACGATCTCAAAGTGGTCTCACT